Transcript asmbl_11061

Sequence
Transcript Sequence for observation asmbl_11061 of TGE0003604:
CGCGGCATCATGAGCAGCAAAGTCTCTCGCGACACCCTCTATGAGGCTGTGCGGGAAGTCCTGCACGGGAACCAGCGCAAGCGCCGGAAGTTTTTGGAGACGGTGGAGCTGCAGATCAGCTTGAAGAACTATGATCCTCAGAAGGACAAACGCTTCTCTGGCACCGTCAGGTTGGCACCGTTCTGACCCCACCCAGCACTCAGTGCCCCCCGTGCCCTGCTACTCTCTTGAGGCTCCTTTTGAGCCCTTGATGGGCAGGCACGTGCTGCACTGAAGTGCCCGGGTAGTTCAGACCCTCTGCTTTGGGCAGGTGCGGCTGGACGGACCCCCACCCTGGGTCTTAAAACAAGAGGGGAGGCGTGGGGAGGCCTTGGCCGAGCCCGCCGGCTAGTTTGAGAAGCCAGACTAGCTGTTGGTGAATGTGAACGCTCTGGGTAAGGCTCAGTGTCTGCAGCGGTCCCAGACCCGTTCACCTGCCCTTCGGACCCAGGGCTGGACATGACCTGTTCTGTCCCCAAAATGCAGGCTTAAGTCCACTCCCCGCCCAAAGTTCTCTGTATGTGTTCTGGGGGATCAGCAGCACTGCGATGAGGCCAAGGCTGTGGATATTCCCCACATGGATATCGAGGCATTGAAAAAACTCAACAAGAATAAGAAACTGGTCAAGAAGCTAGCCAAGAAGTATGATGCCTTTTTGGCTTCAGAGTCTCTGATCAAGCAGATCCCACGAATCCTGGGCCCAGGCCTGAATAAGGCAGGCAAGTTCCCTTCCTTGTTGACCCACAATGAGAACATGGTGGCCAAAGTCGATGAAGTGAAATCCACAATCAAGTTCCAGATGAAGAAGGTGCTATGTCTAGCAGTGGCCGTTGGCCACGTGAAGATGACAGATGATGAGCTTGTGTATAACATCCACTTAGCTGTCAATTTCTTGGTGTCATTGCTCAAAAAGAACTGGCAGAACGTCCGGGCTTTATACATCAAGAGCACCATGGGCAAGCCCCAGCGCCTGTACTAAGGCACA