Transcript asmbl_10770

Sequence
Transcript Sequence for observation asmbl_10770 of TGE0003597:
CGGCGCGGTCGTCGTCGGGGGTGGTAGCGGCAGAGGGGGCGGCGGCAGTGGCAGCATTGGGGACGGCAGCCGTGAAGGCGACGGTGGCGCAGGGCCGGGGACGGGGGGAATGAGGAGGCCGCGGCGGGCCAGCGGCGGAGCTGTGTAGCGGATAAGCGGCTCCCCCTCCTTCCCTTGGTTGAGTCGGGGGCGCGCGCGCGAGCGCGCGGCCGTCCGGAACGGGCTTCCCACCCTCCACTCCCGCGACCCGCACGGCACCCCCACCCGGGCCCGGAGGATGATGAAGCTCAAGTCGAACCAGACCCGCACTTATGACGGCGACGGCTACAAGAAGCGGGCCGCGTGCTTGTGTTTTCGCAGCGAGAGCGAGGAGGAGGTGCTACTTGTGAGCAGTAGTCGCCATCCCGACCGATGGATTGTCCCTGGAGGAGGAATGGAGCCAGAGGAGGAGCCAAGTGTGGCAGCAGTCCGTGAAGTCTGTGAGGAGGCTGGAGTAAAGGGGACATTGGGAAGATTAGTCGGGATTTTTGAGAACCAGGAAAGGAAGCACAGAACATATGTCTATGTGCTCATTGTCACGGAAGTGCTGGAAGACTGGGAAGATTCAGTTAACATTGGAAGGAAGAGGGAGTGGTTTAAAATAGAAGATGCCATAAAAGTGCTGCAGTATCACAAACCGGTGCAGGCGTCGTATTTTGAAACATTGAGGCAAGGCTACTCAGCCAACAATGGCACCCCGGTCGTGACCACCACATACTCAGTTTCTGCTCAGAGCTCTATGCCAGGCATCAGATGACTGAAGACTTCCTGTAAGAGAAATGGAAATTGGAAATTAGACTGAAGTGCAGATCTTCCCTCTCACTCTTGCTCTTTTCACCTCTCTTCACAGGCCTCCTCTTTCAAATAAGGCATGACGGGCAGCAGAGGAAGGGTTTATTGATAATGTTCCTGTTTGGTGTTAAGTGATGGGGCTTTTTCTTCTCGTTTTTTTTTGAGGGGGGTGGGGGTTGGGTATGTAATTTGTAAGTACTTTTGTGCATGATCTGTCCCTCCCTTTTCATACCTCTACAATTCTCTAAAAAGAGGCAGACAGCCTTCCCTTTGCCTTGGATTCTGAAGTATTCCTCTTTGTCTCATCCCATCCCTGGCCAGACATTTTTCTTTGATTTTTAATTTTTTTAAATTAAAAGCTACCAATATGAGATAAAAACTTTCAAGAATTTGTTCTGTAATGTGCTGTTCAGTCCAGTAGGTTGGTCAGTTTCACTGCAGAATACATTTATCTACACATTATATACTGGGCATATAATATGTAAATAAATGACTTTTAGAAGAAAAATTTAACAGTTTAAATTTTTTTCAAGGTTTTGTTTTGTTTTTTAAATTTGGGGTGTTTCTGAAATGGAGAGCCTCACAATTTACTTTTTAATTTTTCCTGCTAGTGTCTAGATAAGTCTTCCTGTCCTTTCTCTTTTCCCCAG