Transcript asmbl_10258

Sequence
Transcript Sequence for observation asmbl_10258 of TGE0003561:
GAAAGGCGCCGCCGCCGCCGCTGTTTCGTAGCCGGGGCTGCGGCCGCAAGAAGAAGGATCTCCCTCTCGCTCCCCGCCGGCGCCTGGCCCGCCCGCTACGCCCCGACGCGTCTCCCATGCCTGCCCCCGGCCCGGCTGCCGACGGACGTCGCGTCAGCGCCCGGATTTAACACGGAAGCCCGGGTCGGGGGCCGCGGGGGGAGGACGAGGGAGACCCGGTAGGTCCCGCGCCCTTCTCGGCCCGGCGCGGCGCCTCGGCGGGAGCCATGACCTCGCTGACCCAGCGCAGCTCGGGCCTGGTGCAGCGGCGCACCGAGGCCTCCCGCAACGCCGCCGACAAGGAGCGGGCGGCGGGCGGCGGCGGCGGAGGCAGCGGCGAGGACGACGCGCAGAGCCGCCGCGATGAACAGGACGACGACGACAAGGGCGACTCCAAGGAAACGCGGCTGACCCTGATGGAGGAGGTGCTCCTGCTGGGCCTCAAGGACCGAGAGGGTTACACATCTTTTTGGAATGATTGTATATCATCTGGATTACGTGGCTGTATGTTAATTGAATTAGCATTACGAGGAAGATTACAACTAGAGGCTTGTGGAATGAGACGTAAAAGTTTGTTAACAAGAAAGGTGATCTGTAAGTCTGATGCCCCAACAGGGGACGTTCTTCTTGATGAAGCTCTGAAGCATGTTAAGGAGACTCAGCCTCCAGAAACAGTCCAGAACTGGATAGAGTTACTTAGTGGTGAGACGTGGAATCCATTAAAACTGCATTATCAGTTAAGAAATGTGCGGGAACGATTAGCTAAAAACCTGGTAGAAAAGGGTGTACTAACAACAGAGAAACAGAACTTTCTACTTTTTGACATGACGACACATCCCCTCACCAACAACAACATTAAGCAGCGCCTCATCAAGAAGGTTCAGGAAGCTGTTCTTGACAAATGGGTGAATGACCCTCACCGCATGGACAAGCGCTTGCTGGCCCTCATTTACCTAGCCCATGCCTCCGATGTTCTGGAGAATGCTTTTGCTCCGCTTCTGGATGAGCAGTATGATTTAGCTACGAAGAGAGTGCGGCAGCTCCTTGACTTAGATCCTGAAGTGGAATGTCTGAAGGCCAACACCAACGAGGTTCTGTGGGCGGTGGTGGCAGCATTCACCAAGTAACTCTGCTCAGAATGAAGTATTCTCCTTCCTCTCATGTAAACCAGTAGTTTTTCTTCTATTGACTTCTGGTTTTCTGCAGTTTGTATTTTCCCACACTATAATTGGCTTTTATTTTATGAAATAGTAAGTGGCTTTTTAAAAATATATATATATGTATGCAGGATTCTGCTGGTACGAGAGGCCTTCCTCTTTCTGTTTTAAAAAAAGTTTTACTGCCATATTGGCATTCCATTCCTTGTTGCCATTCTCACCATTACCTGTTTGGGGTTTCTGGTATGCTTTGACTTTCAAAGTACCTCCAGTCTCCTTACATGCACATCTTTTGGATTACCTCAGGTTGAGTTGTTCCCACATGTGCATGCACATCTCATATTCTGCCTACAGTTCAGACGGAAGTCACAAAAAGGCCTTTAACTCACCAAAGGTAAATATCTTTATCTATTAGGACATTTTATACATAGACCTCAGTTGAGATGTATACTTAGCAAAATTATTTTTAAATTGAAACAACACAGTAAATAATATAAAATGCCCCTTGGATTTTGCTTCCCATACGAATCTATTATAAGACTTGTTATAATTTTAACTATTAAATCACAAAGGTCCAGTCGTTTCACAAAGCCAGTTTGGGATAGGCTGCATTCCAGTTATGCTGTATATAGTTTGAATTATATATAAATTGCCCCTTCTGGCCACCCCACCTCCATCTTAGTATTTTGCAAGATTTAATTAGTTGCACACCTGGTGCCCCTCACTTGCTTTAGTCATTATTTGATGGCAAAATAGACCCCTCATCATTGAAGGAGAGAGAGGTGTGTCTGGTCCTGATATTTTTTTAGCTGTGCCATTCATGGCACTCTTTGCCTATGCATCTCCTTTTTGGAATGATTTTTGAGTCTTACTGTTTTTATCATTTCTGTAGGGAAGAGGCTTGTGACCAGTACTAATCTTGAGTACAGTTTTTTCTTTTTTTGACCATAAGTAAATTAATGTCTGCTCTTAAATGTCATTTATCGACTCACACTTTCTTGGGGAAAAAAATTAAATGTCAGTCCTAGCAGATTTTGCATGTAAATTGTTAGCAAGTGATGACTACAATTCAGATGATTAAGAATTTTGTAACAGAAGCTCTGCTATGTTTTAATTTTTATATACAATTATGATAATTAGCACATTGTAAGAATATAAACCTTTGCTTTTTAAAGTTTATTTTTACTATTTCTTTATCACTGTTTATCATATCACCATTGGTTTCATAATGTAAATACTATATATTGAAAAAACGTCAAATTTTGTATTACTGTAGTTCATGTTAATAGTGGGGCTTTCAGGTGTTTAGAGATTTTTTTGGTTAACAGTCAATGCAAAAGTACTAGATGGTGTATAACTCTAGAGTTGAATTTTAAGGGATTCTCTAATCTGTATACTACCTTTTTAACTGAAGTAATAAAATAAACTATGATCTTGAAAGTGCCTGAATCAGA