Transcript asmbl_46650

Sequence
Transcript Sequence for observation asmbl_46650 of TGE0002309:
GGGAGAGGCTGACCGTTTCCGCTTCCGTCCACTTGGCGAGTGAGACGCTGATGGGAGGATGGACGTACTGGTGTCTGAGTGCTCCGCGCGGCTGCTGCAGCAGGAAGAAGAGATTAAATCTCTGACTGCTGAAATTGACCGGTTGAAAAACTGTGGCTGTTTAGGAGCTTCTCCAAATTTGGAGCAGTTACAAGAAGAAAATTTAAAATTAAAGTATCGACTGAATATTCTTCGAAAGAGTCTTCAGGCAGAAAGGAACAAACCAACTAAAAATATGATTAACATTATTAGCCGCCTACAAGAGGTCTTTGGTCATGCAATTAAGGCTGCATATCCAGATTTGGAAAATCCTCCTCTGCTAGTGACACCAAGTCAGCAGGCCAAGTTTGGGGACTATCAGTGTAATAGTGCTATGGGTATTTCTCAGATGCTCAAAACCAAGGAACAGAAAGTTAATCCAAGAGAAATTGCTGAAAACATTACCAAACACCTCCCAGACAATGAATGTATTGAAAAAGTTGAAATTGCTGGTCCTGGTTTTATTAATGTCCACTTAAGAAAGGATTTTGTATCAGAACAATTGACCAGTCTTCTAGTGAATGGAGTTCAACTACCTGCTCTGGGAGAGAATAAAAAGGTTATAGTTGACTTTTCCTCCCCTAATATAGCTAAAGAGATGCATGTAGGCCACCTGAGGTCAACTATCATAGGAGAGAGTATAAGCCGCCTCTTTGAATTTGCAGGGTATGACGTGCTCAGGTTAAATCATGTAGGAGACTGGGGGACCCAGTTTGGCATGCTCATCGCTCACCTGCAAGACAAATTTCCAGATTATCTAACAGTTTCACCTCCTATTGGGGATCTTCAGGTCTTTTATAAGGAATCTAAGAAGAGGTTTGATACTGAGGAGGAATTTAAGAAGCGAGCATATCAGTGTGTAGTTCTGCTCCAGGGTAAAAACCCAGATATTACAAAAGCTTGGAAGCTTATCTGTGATGTCTCCCGCCAAGAGTTAAATAAAATCTATGATGCATTGGACGTCTCTTTAATAGAGAGAGGGGAATCCTTCTATCAAGATAGGATGAATGATATTGTAAAGGAATTTGAAGATAGAGGATTTGTGCAGGTGGATGATGGCAGAAAGATTGTATTTGTCCCAGGGTGTTCCATACCATTAACCATAGTAAAATCAGATGGAGGTTATACCTATGATACATCTGACCTGGCTGCTATTAAACAAAGACTATTTGAGGAAAAAGCAGATATGATTATCTATGTTGTGGACAATGGACAATCTGTGCACTTCCAGACAATATTTGCTGCTGCTCAAATGATTGGTTGGTATGACCCTAAAGTAACTCGAGTCTTCCATGCTGGATTTGGTGTGGTGCTAGGGGAAGACAAGAAAAAGTTTAAAACACGTTCGGGTGAAACAGTGCGCCTCATGGATCTTCTGGGAGAAGGACTAAAACGATCCATGGACAAGTTGAAGGAAAAAGAAAGAGACAAGGTCTTAACTGCAGAGGAATTGAATGCTGCTCAGACATCCGTTGCGTATGGCTGCATCAAATATGCTGACCTTTCCCATAACCGGTTGAATGACTACATCTTCTCCTTTGACAAAATGCTAGATGACAGAGGAAATACAGCTGCTTACTTGTTGTATGCCTTCACTAGAATCAGGTCTATTGCACGTCTGGCCAATATTGATGAAGAAATGCTCCAAAAAGCTGCTCGAGAAACCAAGATTCTTTTGGATCATGAGAAGGAATGGAAACTAGGCCGGTGCATTTTACGGTTCCCTGAGATTCTGCAAAAGATTTTAGATGACTTATTTCTCCACACTCTCTGTGATTATATATATGAGCTGGCAACTGCTTTCACAGAGTTCTATGATAGCTGCTACTGTGTGGAGAAAGATAGACAGACTGGAAAAATATTGAAGGTGAACATGTGGCGTATGCTGCTATGTGAAGCAGTAGCTGCTGTCATGGCCAAGGGGTTTGATATCCTGGGAATAAAACCTGTCCAAAGGATGTAATCCTTCATAGGTTTGAACACTGTGTGTTTTTACCAAAGTGGCCATTGGCACTGTTTGCTTTTTTACAATCATGTGGACACAAGCATAAGTAAAGAAAATTTGTCAACCAGGCAAAA