Transcript asmbl_9507

Sequence
Transcript Sequence for observation asmbl_9507 of TGE0007905:
AGCAACAGCAGCAGCAGCAGCAGCCTCGCCCTCCTCCTCGCCAGCAGGAAAGAGCCCACTTGGAGAGTCTGGGGCTCAGTAGGCCTAGTCCCCAGCTGTTGGCAGAAACCCCTGTGCCTGGCCTCCCTGAGTTCCCACGGGCAGCCTCCCAGCAGGAGATCGAGCAGTCCATCGAAACCCTCAACATGCTGATGCTGGACCTGGAGCCAGCTGCGGCTGCCGCCCCCCTGCACAAATCCCAGAGTGTCCCAGGGGCCTGGCCAGGGGCCTCCCCGCTCTCTTCCCAGCCCTTCTCCGGCTCCTCCTGCCAGTCCCATCCGCTGACCCAGTCCAGATCTGGCTACATCCCCAGTGGGCATTCCTTGGGAACCCCTGAGCCAGCTCCACAGGCCTCCCTGGAGTCCGTCCCTCCTGGCAGGCCTTACTCACCTTATGATTATCAGCCATGTCCGGCTGGGCCCAACCAGAGCTACCGTCCAAAGAGCCCAGCTTCCTCCTCCACGTCCTCTGCCTTCCTTCCAACCACTCACAGCCCTTCAGGGCCTCAGCAGCCTCCGGCATCTCTCCCTGGCCTCACCGCTCAGCCTCAGCTCTCACCAAAGGAAGCGACTTCAGATCCATCCCGAACTCCGGAGGAGGAACCCTTGAACTTGGAGGGGCTAGTGGCCCACCGGGTAGCAGGGGTGCAGGCTCGGGAGAAGCAGCCTGCAGAGCCCCCGGCCCCTCTCCGGAGGCGGGCGGCCAGTGATGGACAGTATGAGAACCAGTCTTCAGAACCCTCATCTCCCCGGAGCCCTGGGGTTCGCTCCCCTGTCCAGTGCGTCTCCCCAGAGCTGGCTCTCACCATCGCTCTTAATCCTGGAGGACGGCCCAAAGAGCCCCATCTGCACAGCTACAAGGAGGCTTTTGAGGAGATGGAGGGAACCTCTCCGACCAGCCCACCGCCCAGTGGGGTGCGCTCCCCTCCAGGTCTGGCCAAGACACCCCTGTCTGCTCTGGGCCTGAAACCCCACAACCCAGCGGACATCCTGTTGCACCCCACAGGTGAGCCTCGGAGCTACGTCGAGTCGGTGGTGCGGACGGCAGTAGCTGGGCCCCGAGCTCAGGACCCTGAGCCCAAGAGCTTTAGCGCCCCAGCTGCCCAGGCCTATGGCCATGAGACGCCCCTGAGGAATGGGACCCTGGGTGGCTCCTTTGTCTCCCCCAGCCCCCTCTCCACCAGCAGCCCCATCCTCAGCGCTGACAGCACTTCAGTGGGGAGTTTCCCGTCAGGAGAGAGCAGTGACCAGGGCCCCCGGACACCCACCCAGCCTTTGCTGGATTCCGGCTTCCGCTCCGGCAGCCTGAGCCAGCCCAGCCCTTCGGCTCAGAGAAGCTACCAGAGTTCTTCTCCTCTCCCGGCCGTGGGCAGCAGCTACAGCAGCCACGACTACTCACTGCAGCAGTTCAACTCCCCAGAAAGCCAGGCCCGGGCTCAGTTTGCTGTGCCCAGCGTCCACACGGTACCCGGGAGCCCTCAGGCACGCCAGAGGACAGTGGGCACCAATACTCCCCCTAGCCCTGGCTTTGGTCGCCGAGCCATCAACCCCAGCATGGCTGCCCCTGGCAGCCCCAGTTTGAGCCACCGCCAGGTGATGGGCCCATCAGGAGCTGGTTTCCATGGTAACACAGTTTCCAGCCCCCAGAGCAGTGCAGCGACCACTCCAGGAAGCCCCAGCCGGGGCCAGCACCCTGGGGCCCACCAGGCCTCAGGCCTCCATGGCAGTGTGGTCACCACTCCAGGGAGCCCAAGCCTGGGCCGGCACCCAGGAACCCACCAGGGCAACCTGGCCCCCAGTCTCCATGGCAACACAATAGCCAGCCCCGGAAGCCCCAGCCTGGGCCGGCACCTGGGAGGATCTGGATCTGTGGTTCCCGGAAGCCCCAGCTTAGACCGGCACGTGGCCTATGGCGGCTACTCCACCCCTGAGGACCGGAGACCCACGCTGTCCCGGCAGAGCAGTGCCTCCGGCTACCAGGCTCCCTCCACGCCCTCCTTCCCTGTGTCCTCTGCCTACTACCCTGGTCTGAGTAGCCCTGCCACCTCCCCCTCGCCGGATTCAGCAGCCTTCCGGCAAGGGAGCCCAACACCGGCCTTGCCAGAGAAGCGGAGGATGTCCATGGGAGACCGGGCGGGCAGCCTCCCCAACTATGCTACCATCAACGGGAAGGTGTCCTCCTCGCCTGTCGCCAGCGGCATGTCCAGTCCCAGTGGGAGCAGCACCGTCTCCTTCTCTCATACTCTGCCTGACTTCTCCAAGTACTCCATGCCAGACAACAGCCCTGAGACCCGGGCTAAAGTGAAATTTGTCCAGGACACTTCCAAGTATTGGTACAAGCCTGAGATCTCTAGAGAGCAGGCCATCGCACTCCTGAAGGACCAGGAACCAGGGGCCTTCATCATCCGTGACAGTCACTCCTTCCGAGGGGCCTATGGGCTGGCCATGAAGGTGTCATCTCCCCCTCCGACCATTATGCAGCAGAATAAAAAAGGGGACATGACCCATGAGCTGGTGAGACATTTCCTGATAGAGACTGGCCCTAGAGGAGTCAAGCTCAAGGGGTGCCCCAATGAGCCAAACTTTGGATCCCTCTCTGCCCTGGTCTACCAGCACTCCATCATCCCACTGGCTCTGCCCTGCAAGCTGGTCATTCCAAACCGAGATCCCACAGATGAATCGAAAGATAGCTCAGGCCCTGCCAACTCAACCACTGACCTGTTGAAGCAAGGGGCAGCCTGTAACGTGCTCTTCGTCAACTCTGTGGATATGGAGTCACTCACTGGGCCACAGGCCATCTCCAAAGCCACTTCTGAGACACTGGCTGCTGACCCCACGCCGGCTGCCACCATTGTTCACTTCAAAGTTTCTGCCCAGGGAATTACACTGACTGACAACCAGAGGAAGCTCTTCTTCAGACGACACTACCCCCTCAACACTGTCACTTTCTGTGACCTGGATCCACAGGAGAGAAAGTGGATGAAGACGGAGGGAGGGGCCCCTGCTAAGCTCTTCGGCTTTGTGGCCCGGAAGCAGGGCAGCACCACGGACAACGCCTGCCACCTCTTCGCTGAGCTTGACCCTAACCAGCCTGCTTCCGCCATTGTCAACTTTGTCTCCAAGGTCATGCTGAGTGCTGGCCAGAAGAGATGAACCCACCCCTTGCCTGGGGCCAGGGCAGTGGGGATGGGGCATGTGGGGGCGGGGAGACCCATGAATCCTGACCACCTTTAAATCCAGAAGGAGGACTTTGGGCTAATTTTGGAGAAGGAGAGAAGAAAGTGCAATGTGGGGAGAGGGAAGTGAATCGCAGAGGGGAGGGGGA