Transcript asmbl_46639

Sequence
Transcript Sequence for observation asmbl_46639 of TGE0002306:
CTTTCGGTCTCTCAGCGGCCGGTTTCTGCGTCCGCTGCCGCAGGTTCCACCGCGCTCCAGGTATTTTTTTTTCTGAAGGAAAGCTGCTTCCTCATATGTTTCAAGAATGGCTCTCCCTATCATTGTAAAATGGGGTGGACAGGAGTATTCAGTGACCACACTTTCAGAAGATGATACTGTGCTCGATCTCAAACAGTTTCTCAAGACCCTTACAGGAGTTCTTCCAGAACGCCAAAAGTTACTTGGACTCAAAGTTAAAGGCAAACCTGCAGAAAATGATGTTAAGCTTGGAGCTCTCAAACTGAAACCAAATACTAAAATCATGATGATGGGAACTCGTGAGGAGAGCTTGGAAGATGTCTTAGGTCCACCCCCTGACAATGATGATGTTGTTAATGACTTTGATATTGAAGATGAAGTAGTTGAAGTAGAAAATAGGGAAGAAAACCTACTGAAAATTTCTCGCAGAGTGAAAGAGTACAAAGTGGAAATTTTGAATCCTCCCAGGGAAGGGAAAAAGCTTTTGGTGCTAGATGTTGATTATACATTATTTGACCACAGGTCTTGTGCAGAGACTGGGGTAGAATTAATGCGGCCATATCTTCATGAATTTCTAACATCTGCCTATGAAGATTATGACATTGTTATTTGGTCTGCAACAAATATGAAGTGGATTGAAGCTAAAATGAAAGAGCTGGGAGTGAGCACAAATGCAAATTATAAGATTACTTTCATGTTGGATAGTGCTGCTATGATAACAGTACATACTCCAAGGAGAGGATTAATAGACGTAAAGCCTCTTGGTGTTATATGGGGAAAGTTTTCGGAGTTTTACAGCAAGAAAAACACCATTATGTTTGATGACATAGGGAGAAATTTTCTAATGAACCCACAGAATGGACTAAAGATAAGGCCTTTTATGAAAGCGCACCTAAATCGTGATAAAGACAAAGAACTTTTAAAATTAACTCAGTACCTCAAGGAGATAGCAAAATTAGATGACTTTTTGGATCTAAATCACAAATATTGGGAAAGATATCTCTCAAAGAAGCAAGGACAGTAGTTACAAGTTATACTGGCAGTTATTGAAGATACTTAAGATCCAAGAACTTCTTGCTTTTATGCTAGAAATCATTATGATAGTGCTGGACACTGAAGCAAATACCATACTGCTTATACTTGGTCTTCC