Transcript asmbl_8768

Sequence
Transcript Sequence for observation asmbl_8768 of TGE0017802:
GGGGCCGCCTCTAACCAGCGTTTACCTTTTATGGTAATAACGCAGCCGGCTGGGCTTCCTTTGTCCCCAATCTGAGCGCGCGCCGGCGCCCCCTGGCGGCCAGAAGGCTCGCCGTGCCGGAAGTGGGCAGGGCGGGGGCGGCCCCACTCGACCCCGGCTCATGGCCCAGCTCTCCCCGCAGCTCACCATGGATGACGATATCGCCGCTCTCGTGGTCGACAACGGCTCCGGCATGTGCAAGGCCGGCTTCGCGGGCGACGATGCCCCCCGAGCCGTCTTTCCCTCCATCGTGGGGCGCCCCCGGCACCAGGGCGTGATGGTGGGCATGGGCCAGAAGGATTCCTACGTGGGCGACGAGGCCCAGAGCAAGAGAGGCATCCTGACCCTGAAGTACCCCATCGAGCACGGCATCGTCACCAACTGGGATGACATGGAGAAGATCTGGCACCACACCTTCTACAACGAGCTGCGTGTGGCCCCCGAGGAGCACCCTGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACCGTGAGAAGATGACTCAGATTATGTTCGAGACCTTCAACACCCCAGCGATGTACGTGGCCATCCAGGCCGTGCTGTCCCTGTACGCCTCTGGCCGTACCACTGGCATCGTGATGGACTCCGGTGATGGAGTCACCCACACTGTGCCCATCTACGAGGGGTACGCCCTCCCCCACGCCATCCTGCGTCTGGACCTGGCTGGCCGGGACCTGACGGACTACCTCATGAAGATCCTCACGGAGCGTGGCTACAGCTTCACCACCACGGCTGAGCGGGAGATCGTGCGTGACATCAAGGAGAAGCTGTGCTACGTCGCCCTGGACTTCGAGCAGGAGAT