Transcript asmbl_860

Sequence
Transcript Sequence for observation asmbl_860 of TGE0007816:
GGGAGCGGGATCTCGACTTCCGTATTTACCAATGGCTCCAAAACATACCTCACGTGCAACTTGAGTAGCAGCAACACTGAGATCGTCGGCCACCGCTGGATGAAAGGGGACAAGGTGCTGAAGGAGGATGAGCTGCCCGGCCTGAAAACGGAGTACGAGTTGGACACAGATGAGAGTGGGGGCCAGTACCTCTGTGTCTTCCTCCCGGAGGTCGTGGGCAAGGCCAGCATCAATGTGCCAGGACCCCCCAGAGTGAAGGCCGTGAAAAAGTCAGAGCACGCCACCGAGGGGGAGGGCGTCGTGCTGGCCTGCAAGTCTGAGTCCTTCCCCCCGATCACCGAGTGGGTGTGGTACAAGGTGAGTGACACCGAGCAGCAGGTCCTCACCAACAACTCCCAGAATAAGGTCTACGTGGTGTCCGTGGAGACCAGGACGGAGCTTCACATCCTGAACCTGAACTTGGAGACCGACCCCGGCAAGTACGTCTGCAACGGCAGCAGCGTGGAGGGCACCGACCAGGCCGTCATCGTCCTGCACGTTCGCAGCCAGCTCGCCGCCCTGTGGCCCTTCCTGGGCATTGTGGCCGAGGTGCTTGTGCTGGTCACCATCATCTTCATCTATGAGAAGCGGCGGAAGCCGGACGAGGTCCTGGATGACGAGGACACCGGCTCCGCGCCACTGAAGAGCAGTGGGCACCACGTGAACGACAAGGGCAAGAACGTCCGCCAGAGGAACTCCAGCTGAGCGTGCCACCAGACGAGTCTGCACAGGGCCCGAGCGCTGCTGGAGGAGCCCGGTGTGCCTGCGCTTGCCCGATTCCCAGCTCTGTCCTCTCAAAGGAAACCTGCCCAGCGAGAGCAAACGCTGCGAATCCCAGTCACATTTCCTCTCCTTTTAAGAAAACTAAGCTAAGGTTTTCTCTCTGTAGAGTTCCGTTCCTTAGGGGTTTCGTTCCGTCTTTTTAAGAGTGTTCCAGGGGAGTCTCAAGCTTCTCTGTGGGGCCCTAATGCCCCCTCCCCCTGTGTCCCCTTGCTGTCCCCTGGGCGTCCAGCCTTCTAGTCCATCACGTTGGGGCTGCGGGGGGCAGACTGGCCTTTACCTGACACTCCCACCACGGCTCTGCCTCTGAGGCTGCTCAGTGGTCCCTGTCCTCTGCGGAAGGTCATAGGTCGTGGTGCCCAGCATCCTGCCTGTCTGGAGCCAGTGCTGTCACATCACCTCAGGTCTGTGTGACGTGGGACATCCCTGCCCTCATGGCCACCTATCAGGTGTCCTCTTCACTGCTCGGGCAAGTCCCTGTGCTGGGGGTGGTCTGGTTGACCATCTCAGAGCGGGAGTCCTGTGACAGCCCCTTCCCCGTCAGCCCGTGGCCATGCAGAAACGCCCTCCCCCCCGGGCCCACAGCCTTACTGTCCACAGCACCCTGACTCCGGTACCTGCCCCCTGCCTGCTCACCAATAAAGGCTACCCCACCTCGTCCTC