Transcript asmbl_8461

Sequence
Transcript Sequence for observation asmbl_8461 of TGE0007832:
GTCAGAATGGCGGAAGTCCTTCTAGACGCGGAGGCCGCCATCTTAGAACCCAGGCCTACCTCACCCAGGAGATGTATCTGCTTGCTGTAGTCTCAGAGACCAACCGGCTCGCCGCGACACCCAGCCTCTAGCCACCTTTGGCACATCTTAATAGATAGTAAACTATCTTTTTGAGGGCGAATCTTAATCTCCTTGGAAACGCTAAAGACGGCGTCTTCCGGGAAGCCTCGCCCCGTGACCTCAGACGTACACTTCCAGGGCACGAACGTGACCCGTCGCCCCGCCCTTTCCCACTCTCTCTTTCCGGTGGCGGAGTCTGGAGAAGGCACGCAGAAATGGCACCTCGCAAGGGGAAGGAAAAGAAGGAAGAACAAGTCATCAGCCTTGGACCTCAGGTGGCTGAAGGAGAAAATGTATTTGGTGTCTGCCACATCTTCGCATCCTTCAATGACACTTTTGTCCATGTCACCGATCTTTCTGGCAAGGAAACCATCTGCCGTGTGACTGGTGGGATGAAGGTAAAGGCTGACCGAGATGAGTCCGCTCCATATGCTGCCATGTTGGCTTCCCAGGATGTGGCCCAGAGGTGCAAGGAGCTGGGCATCACTGCCCTCCACATCAAACTCCGGGCCACAGGAGGAAATAGGACCAAGACCCCCGGACCAGGGGCCCAGTCAGCTCTTAGAGCCCTCGCCCGCTCAGGGATGAAGATTGGACGGATTGAGGATGTCACCCCCATCCCCTCTGACAGCACCCGCAGGAAAGGGGGTCGCCGTGGTCGCCGTCTGTGAACAGGACTCCTCAAATTGTTTTCTGTTAATAAATTGCCTTTGTGTGA