Transcript asmbl_76021

Sequence
Transcript Sequence for observation asmbl_76021 of TGE0007664:
TTCTTTTAGGAATCTTTATTGATTTCTTTTAAAACAATTTAGCCTTTTGGATCTCGATGCAGTTTATAAAAAAACCTTCCATATAGTTTCATATAAACTGCAGTCAAAAATGTAATTTACTTAGTCAAAGAAGTTATCTGAAGTTGCAAGTTATTTTTTTGTAATATGCAGAACAGTAAAATGTAAGCATGCTCTCGGATGCAGGTGCTCCAGTGTACTATGGAGTTACTTTGAAGAGCTTGCTAAGGTCTGCAGGCAGTTTATGGAATGCAATCATTTTCTCCACAATTTAGGTACATGAGAATAAAACTGATACTTAAGAATAGAGTATTTTTCTCAAAAAAGTTGAGGCAGCTTTTGTTGAATGCTGTCTGTGTGGGTACACTTGCTACACCTTGAACTGTGTGTGCTAAGAGAAACAGACAGCCAGGAGTCCATGTTCATGCTGAAACTTGAAAAATCCCTCCACCTGTATTAAGGAGTTCCAAGAAAAGGAAGAAGGTAAAAGACTATGCAATTGTTTATCATCTTACAGTAATAGAACACACCAAAAAACTTTACATGACAAGGAAGGAAAGTCCCTTCACTGCTTTCAGTCAAGGTCAGTGGTGTCTATAGTGGATAGTGGAGATGGAGCAAGCATAGGATGAGATAAAGCTTAAGTCTACATCTCATGCATAGCTGTCCTTGTTTTGTCCTCGATTGTCTCTCAGACATCCGAATTAGAACTGAGGTTTGTTAACCTGGGGTCCGCATTGATTTCATATCTGTAATGATACCCTTCCATGTGATCCCTGCAGGCATCTCTGATGTTATGCATCCACTTTTTTATCCCCTTGCGGTTCAAATACAAAACCAGTAGGAAAATCGCGCCTATCAGGGCTAAAACAATACCTAGGAAGACATAAGAAGTCTGCAGGGATGGAGGGAGGATAGGATCACAGTCCAGGTCTGAGCTGTTGAGTTCCAAGAGGACCCGATTCCTCATTTTTTCAGGGAATGCACAGGTGAGCCTAGCTTTGCCCTGCACGACCTCTGTCTCCTTGAGCCAGGCCACCATGTCCACCATGTGGCAGTCGCATACCCAGGGATTGTTGTCCAGAAAGACCCTGACTTGGGGCAGGCCCTGCAACTCTGCCAGGGTGCCGTTATGAAGGACCTTGAGGGAGTTGTCCTCCAGGTGGAGGCTTTCTAGGTGTGTCAGGTTGCGGAAGGACACATAAGTCAGGCTCACCAACGAGTTGTTACGCAGGTCCAGGTGCCTAAGGGCCGGCATTTGTGCCAGTACGTCGCGGGGCAGATAGAGCAAGTGGTTGCTGGTCAGCTCCAGGCGGTGGAGCCCGCGCAGAGCCTGGCCAGCTCGCAGGGCCGCTGCCACCATACCTTCGAAGCTACGGTTCTCTCGATCGAACTCAGGAGGCAGGATGTGGTTCAGGAACAGTTCCACCAGAGGGCTGGGGGCAGAGGCGCTGGCGTTTCTGCCCGAGAAAGCGAAGGGGCTGAGGTCGTCCAGCGGGTTGTGGCTAAGGTCGAGCTGGCGCAAGCTGGGCAGTTGCTCGAAGGCGCCAGCGTGCACCTCCTTTAGGCGGCTGCCGCTGAGGTTGAGCGCGGTCAGCTCGTCCAGCGGCGGTCTGCGGGCGAAGGCGCCGGCAGGGAGCACCGCCAGCTGATCGCCGGTGAGGAAGAGGTTGCGCACATAAGGGGGCAAGTCCGCTGGCACCTCGGTCAGGTTGCGGTTAACGCACTTGACGGTGCGCGCCGCCTCGGAGCACTCGCATGGCGGGGGGCACTGGCCTGGCAGCGGGGGCTGTGCGGACACCGCGGAGGCCAGGAACTGCGCGGAGGAGGTGGAGGACGTCGCCGAGGAGGTGAGTGAGGACGAGGTGACCCAGCCCAGGAGGACCACCGCCAGCCACAGCCGAGCGTCCCCGGCGGCGGGGCCCCAGGAGCACCCCCCAGGCATCACGGCACGGGTCTCCCCGGAGCTGGGCTGGGACAGAGCCCGCTCCGAAGGCTCGGGAGCTGGGCCCGGAGAGCGCGGGTCGGCCGGAGGTGTCTAGAGAAAACTTTCCTCTCGTGGGAGGGCTCAGCAACCAGAACTTGGCTAACCCCTTGACCACCGGATGTCCTCCTCCCAGGGCCGATTCCCCCGCCCCTTCCCTCTAGAAAGTACGCACAGCGGGTGTGGACACTCAACTCCCGCTCCTCTTCCTGCCGCCGCCCCCGGGTTGCCACCTCCTCGCCTCTTTTGTTGGCGCCTTGCGCTGGATCCGCTGCAGGACCTGGGACAAGCGGGAGAGAACCGTGAGGAGCGGCAGCGGCCGCAGCTCCCCGAGTACGGAAACCGGCCTAGCCAAGCCAAGTCG