Transcript asmbl_46479

Sequence
Transcript Sequence for observation asmbl_46479 of TGE0002270:
CCTCCTCCCCCCGCCCGCCGCTCCGTGCAGCCTGAGAGGAAACAAAGTGCTGCGAGCAGGAGACGGCGGCGGCGCGAACCCTGCTGGGCCTCCAGTCACCCTCGTCTTGCATTTTCCCGCGTGCGTGTGTGAGTGGGTGTGTGTGTTTTCTTACAAAGGGTATTTCGCGATCGATCGATTGATTCGTAGTTCCCCCCCGCGCGCCTTTGCCCTTTGTGCTGTAATCGAGCTCCCGCCATCCCAGGTGCTTCTCCGTTCCTCTAAACGCCAGCGTCTGGACGTGAGCGCAGGTCGCCGGTTTGTGCCTTCGGTCCCCGCTTCGCCCCCTGCCGTCCCCTCCTTATCACGGTCCCGCTCGCGGCCTCGCCGCCCCGCTGTCTCCGCCGCCCGCCATGGCGACTGCGACCCCCGTGCCGCCGCGGATGGGCAGCCGCGCTGGCGGCCCCACCACGCCGCTGAGCCCCACGCGCCTGTCGCGGCTCCAGGAGAAGGAGGAGCTGCGCGAGCTCAATGACCGGCTGGCGGTGTACATCGACAAGGTGCGCAGCCTGGAGACGGAGAACAGCGCGCTGCAGCTGCAGGTGACGGAGCGCGAGGAGGTGCGCGGCCGTGAGCTCACCGGCCTCAAGGCGCTCTACGAGACCGAGCTGGCCGACGCGCGACGCGCGCTCGACGACACGGCCCGCGAGCGCGCCAAGCTGCAGATCGAGCTGGGCAAGTGCAAGGCGGAACACGACCAGCTGCTCCTCAACTATGCTAAGAAGGAATCTGATCTTAATGGCGCCCAGATCAAGCTTCGAGAATATGAAGCAGCACTGAATTCGAAAGATGCAGCTCTTGCTACTGCACTTGGTGACAAAAAAAGTTTAGAGGGAGATTTGGAGGATCTGAAGGATCAGATTGCCCAGTTGGAAGCCTCCTTAGCTGCAGCCAAAAAACAGTTAGCAGATGAAACTTTACTTAAAGTAGATTTGGAGAATCGTTGTCAGAGCCTTACTGAGGACTTGGAGTTTCGCAAAAGCATGTATGAAGAGGAGATTAACGAGACCAGAAGGAAGCATGAAACGCGCTTGGTAGAGGTGGATTCTGGGCGTCAAATTGAGTATGAGTACAAGCTGGCGCAAGCCCTTCATGAGATGAGAGAGCAACATGATGCCCAAGTGAGGCTGTATAAGGAGGAGCTGGAGCAGACTTACCATGCCAAACTTGAGAATGCCAGACTGTCATCAGAGATGAATACTTCTACTGTCAACAGTGCCAGGGAAGAACTGATGGAAAGCCGCATGAGAATTGAGAGCCTTTCATCCCAGCTTTCTAATCTACAGAAAGAGTCTAGAGCATGTTTGGAAAGGATTCAAGAATTAGAGGACTTGCTTGCTAAAGAAAAAGACAACTCTCGTCGCATGCTGACAGACAAAGAGAGAGAGATGGCGGAAATAAGGGATCAAATGCAGCAACAGCTGAATGACTATGAACAGCTTCTTGATGTAAAGTTAGCCCTGGACATGGAAATCAGTGCTTACAGGAAACTCTTAGAAGGCGAAGAAGAGAGGTTGAAGCTGTCTCCAAGCCCTTCTTCCCGTGTGACAGTATCCCGAGCATCCTCAAGTCGTAGTGTACGTACAACTAGAGGAAAGCGGAAGAGGGTTGATGTGGAAGAATCAGAGGCGAGTAGTAGTGTTAGCATCTCTCATTCCGCCTCAGCCACTGGAAATGTTTGCATCGAAGAAATTGATGTTGATGGGAAATTTATCCGCTTGAAGAACACTTCTGAACAGGATCAACCAATGGGAGGCTGGGAGATGATCAGAAAAATTGGAGACACATCAGTCAGTTATAAATATACCTCAAGATATGTGCTGAAGGCAGGCCAGACTGTTACAATTTGGGCTGCAAACGCTGGTGTCACAGCCAGCCCCCCAACTGACCTCATCTGGAAGAACCAGAACTCGTGGGGCACTGGCGAAGATGTGAAGGTTATATTGAAAAATTCTCAGGGAGAGGAGGTTGCTCAAAGAAGTACAGTCTTTAAAACAACCATACCTGAAGAAGAGGAGGAGGAGGAAGAAGCAGCTGGAGTGGTTGTTGAGGAAGAACTTTTCCACCAGCAGGGAACCCCAAGAGCATCCAATAGAAGCTGTGCAATTATGTAAAATTTTCAACTGTCTTCCTCAAAATAAAGAAGTATGGTAATCTTTACCTGTATACAGTGCAGAGCCTTCTCAGAAGCACAGAATATTTTTATATTTCCTTTATGTGAATTTTTAAGCTGCAAATCTGATGGCCTTAATTTCCTTTTTGACACTGAAAGTTTTGTAAAAGAAATCATGTCCATACACTTTGTTGCAAGATGTGAATTATTGACACTGAACTTAATAACTGTGTACTGTTCGGAAGGGGTTCCTCAAATTTTTTGACTTTTTTTGTATGTGTGTTTTTTCTTTTTTTTTAAGTTCTTATGAGGAGGGGAGGGTAAATAAACCACTGTGCGTCTTGGTGTAATTTGAAGATTGCCCCATCTAGACTAGCAATCTCTTCATTATTCTCTGCTATATATAAAACGGTGCTGTGAGGGAGGGGAAAAGCATTTTTCAATATATTGAACTTTTGTACTGAATTTTTTTGTAATAAGCAATCAAGGTTATAATTTTTTTTAAAATAGAAATTTTGTAAGAAGGCAATATTAACCTAATCACCATGTAAGCACTCTGGATGATGGATTCCACAAAACTTGGTTTTATGGTTACTTCTTCTCTTAGATTCTTAATTCATGAGGAGGGTGGGGGAGGGAGGTGGAGG