Transcript asmbl_72164

Sequence
Transcript Sequence for observation asmbl_72164 of TGE0007455:
CGCGGCTGTGTTTGCGTTGCGGCCTGTGCGAGTAGTCGCTTCGGAACCAGTCTCCCGGCGAGCGGCGCGCAGAAACCTCGAACCGGTGGAGCCCACTCGTAACCTGGAGCCCATAAGGCCGCGAAGACAGTACCTTTTCCTTAGCGGCGGACTGCTGCAGTAAGAATGTCTTTCCCCCCTCATTTGAATCGCCCTCCCATGGGAATCCCAGCACTCCCACCAGGGATCCCACCCCCACAGTTTCCTGGCTTTCCTCCACCTGTACCTCCAGGAACCCCAATGATTCCTGTACCAATGAGCATTATGGCTCCTGCTCCAACTGTCTTAGTACCCACTGTGTCCATGGTTGGAAAGCATTTGGGAGCAAGAAAAGATCATCCAGGCCTAAAGACTAAAGAAAATGATGAAAATTGTGGTCCCACTACTACGGTTTTTGTTGGCAACATTTCTGAGAAAGCCTCAGACATGCTTATAAGACAGCTCCTTGCTAAATGTGGCTTGGTTTTAAGCTGGAAGAGAGTACAAGGTGCATCTGGAAAACTTCAAGCCTTCGGATTCTGTGAGTATAAGGAGCCTGAATCTACCCTCCGTGCACTCAGGTTATTGCATGACCTACAGATTGGAGAGAAAAAGCTACTTGTTAAAGTTGATGCAAAGACAAAGGCACAACTGGATGAATGGAAAGCAAAGAAGAAAGCTTCTAATGGGAATGCCAGGCCAGAAACTGTCACTAATGATGATGAAGAAGCCTTAGATGAAGAAACTAAGAGAAGAGATCAAATGATCAAAGGGGCCATTGAAGTTTTAATACGAGAATACTCCAGCGAGCTCAATGCCCCTTCACAAGAATCTGACTCTCATCCCAGGAAGAAGAAAAAGGAAAAGAAGGAGGACATTTTCCGCAGATTTCCGGTGGCACCACTGATCCCTTATCCGCTCATCACTAAGGAGGATATAAATGCTATAGAAATGGAAGAAGACAAAAGAGACCTGATATCCCGAGAAATCAGCAAATTCAGAGACACACACAAGAAACTGGAAGAAGAGAAAGGCAAAAAAGAAAAAGAAAGACAGGAAATTGAGAAAGAACGGAGAGAAAGAGAGAGGGAGCGTGAAAGGGAACGAGAAAGGCGAGAACGGGAACGAGAAAGAAAAACGTGAACGAGAAGGAGAAGGAACGGGAGCGGGAACGAGAACGGGATAGGGATCGTGACCGGACAAAGGAGAGAGATCGAGATCGGGATCGAGAGAGAGATCGGGACCGCGATCGTGAGAGGAGCTCAGATCGAAATAAGGATCGGAGTCGATCTAGAGAAAAGAGCAGAGATCGTGAAAGGGAACGAGAGCGAGAAAGAGAAAGAGAGCGAGAACGAGAACGAGAGAGAGAACGTGAGCGAGAGAGAGAGCGAGAAAGGGAACGAGAGCGTGAGAGAGAGAAAGACAAGAAGAGAGACCGAGAAGAGGATGAAGAAGATGCATATGAACGAAGAAAACTTGAAAGAAAACTTCGAGAGAAAGAAGCTGCTTATCAAGAGCGCCTTAAGAATTGGGAAATTAGAGAACGGAAGAAAACCCGGGAGTATGAGAAAGAGGCTGAAAGAGAAGAAGAAAGAAGAAGAGAAATGGCAAAAGAAGCTAAACGACTAAAAGAATTCTTAGAGGATTATGATGATGATAGAGATGATCCCAAATATTACAGAGGAAGTGCTCTTCAGAAAAGATTGCGTGATAGGGAAAAGGAAATGGAAGCAGATGAACGGGATAGGAAAAGAGAGAAGGAAGAGCTAGAGGAAATCAGGCAGCGCCTTCTGGCAGAAGGGCACCCGGATCCAGATGCAGAGCTCCAGAGGATGGAACAAGAGGCTGAGAGGCGCAGACAACCACAAATAAAGCAAGAACCAGAATCTGAGGAAGAAGAAGAAGAAAAACAAGAAAAAGAGGAAAAACGAGAAGAACCCATGGAAGAGGAAGAAGAGCCAGAGCAGAAACCCTGTCTCAAACCAACTCTGAGGCCCATCAGTTCTGCTCCATCTGTTTCCTCTGCCAGTGGCAATGCAACCCCCAACACTCCTGGGGATGAGTCTCCCTGTGGTATTATTATTCCTCACGAAAATTCGCCAGATCAACAACAACCTGAGGAGCATAGGCCAAAAATAGGACTAAGTCTTAAACTGGGTGCTTCCAATAGTCCTGGTCAGCCTAATTCTGTGAAGAGAAAGAAACTCCCCGTAGATAGTGTCTTTAACAAATTTGAGGATGAAGACAGTGATGATGTACCCCGAAAAAGGAAACTGGTTCCCTTGGATTATGGTGAAGATGATAAAAATGCTGCCAAAGGCACTGTAAACACTGAAGAAAAGCGCAAACATATTAAGAGTCTCATTGAGAAAATCCCCACAGCCAAACCAGAGCTCTTTGCATATCCCCTGGATTGGTCTATTGTGGATTCTATATTGATGGAACGACGAATTAGACCATGGATTAATAAGAAAATTATAGAATACATAGGTGAAGAAGAAGCTACATTAGTTGATTTTGTTTGTTCTAAGGTTATGGCTCATAGTTCACCTCAGAGCATTTTAGATGATGTTGCCATGGTACTTGATGAAGAAGCAGAAGTTTTTATAGTCAAAATGTGGAGATTATTGATATATGAAACAGAAGCCAAGAAAATTGGTCTTGTGAAGTAAAACTCTCTTTACACTTAAGAGTTCCATTTCAGATACCATCTTTCCCATCCTTCAAAGGACTTTGAATTTTTCTTTGTCTTCAAAGACATTTGCAAGATCTGTAATTTTTTTTTAATGTAGAAAATGTGAATTTTTTTTGTCCTCCAATTCGTTGATGCCTTGTGTACTCTCTTGGTTGTAAAGACATCTGAATCCTACTTTGGTTCTCTTTATACTCACCAGGTACAAATTACTGGTATGTTTTATAAGCCGCAGCTACTGTACACAGCCTATCTGATATAATCTTGTTCTGCTGATTTGTTCCTTGTAAATATTAAAATGACTCCCCAATTCTTTTGCAGAATTGCACTTAATATTGAACTGTACTGTAAAGGAACCAACACGAACAATTTTAATTGAAAGAATACCAGTCCTTCCTTCCCTATTTGATCAGAATTGGCAAGCTTTCATGAAGGCATGAAATTAATTTTTGAAATTAGAGTGCGAAAATTAGCAGACCATCCATTCCTACTGTATCTGTATGAATGTGTTTGTGTGAATGTATATATAAAAGTGTTACTTTGCCCTGATTTGCTTTGGAGGGCTCCCGTAAACATTTCCTAACTGAAGAATAGAATCGTAAAGGAAACGTGGTGTTGTGCCAACCCAAATGTCTGGGATAATTAGGTTATTAGTCTCCCAGAGCATGGTATTCTTTTCTGGCAAGCAACAGTCTGTTGAATAGCATGGGGTTCTCCTGTTGATAGCTGGCTGCTTCAGCCTCTCTTTTTAAGGGACTGTGAATCACTGATCCCCTGCCCCTCAATTTCATTGTGCAGAGATGAGTCAGATCCTTAGATTCTGGAGAGCTTTATTTAATGCATTTTTGCACTAATTGGTCTTTAGCTTAATTTTGGTGTACCCCTTTTGTTGGGAAAAAAATGGAAAAGCATAAATGAGGGAAAAAAAACTTGAGAAACAAAAGATAAAATTAGGCCATTTGACAGACTAGGAAAATTTGACAAAATATACTAGGAATTCAGCATGGCATTTTACGTTTACATCTTATTTCTAAGGATAAAGTAAATCATTTAAGGCAGTTACCACTAATTTTTTGTTTTTGTTTTGATAAAGGGTTTATAGCTTGTGCTTGTGTATATACACACACACTTTGTTTACCTCTGCTCATCAAAGTTTGAAAATATACTGATGTTGTTAGAGACATACATTTCTTTATTGTAGATCAGAACTTCACCAGGGAGCAAAATTACCTGAAAACGTAACGAGTTTTAAACAGTTCTTAACAGAGTAGGTGTGGCTATTACCATGTCTGAGTATTTATTTAAAAGAAAAATAAAGATTTGGTGGCGGTGGGGGGATGTTAAAAAGCATAACTGAGCTTGAGTTATTAGATTTTTTTACATCTTAAAGAGGACATTTGAAAACACTGTTCTTAATATTGGACCATGACATGGTTCTATTATGTAAATATTTCAAATATTAAAAATGTATATATTTGATCTTGGGGACTCATTCTTTCAGAGTCTTATTAAATAAATGGCATCATGCTGTAATTGTGCAGTGCATACTAGAAACTTAACTTGAAAATATGGGCTAAATTAATTTTTATGAATATTAGTGACTGAAGGGCAAAGAGGATATTACCTAATTTTAGATTACTCTATATGTCTATGGA