Transcript asmbl_13869

Sequence
Transcript Sequence for observation asmbl_13869 of TGE0000220:
CCCCGAGCCGCTCCTGACCCACCTACCCCAGCTCTCGCGCCGCGTGCAGAGGTGCTCAAGCCTCCTCGCGGTCCGCAGTCAGTGCCGCCGCGCCCGGCCTCCCGCACGCCCCGCAGGTAGCGCCCCCGCCCGCGGCCCAGAGTGCGCTCGCGCCGGCACCAGCTCCCGGATAAACGGCGCGCCGCGCGGAGATGACAGCCGAGGAGATGAAGGCGACCGAGAGCGGGGCGCAGTCGGCGCCGCTGCCCATGGAGGGAGTGGACATCAGCCCCAAACAGGACGAAGGCGTGCTGAAGGTCATCAAGAGAGAGGGCACAGGTACAGAGATGCCCATGATTGGGGACCGAGTCTTTGTCCACTACACTGGCTGGCTATTAGATGGCACAAAGTTTGACTCCAGTCTGGATCGCAAGGACAAATTCTCCTTTGACCTGGGAAAAGGGGAGGTCATCAAGGCTTGGGACATTGCCATAGCCACCATGAAGGTGGGGGAGGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAGCAGGCAGTCCTCCAAAGATTCCCCCCAATGCCACGCTTGTATTTGAGGTGGAGTTGTTTGAGTTTAAGGGAGAAGATCTGACGGAAGAGGAAGATGGCGGAATCATTCGCAGAATACAGACTCGCGGTGAAGGCTATGCTAAGCCCAATGAGGGTGCTATCGTGGAGGTTGCACTGGAAGGGTACTACAAGGACAAGCTCTTTGACCAGCGGGAGCTCCGCTTTGAGATTGGCGAGGGGGAGAACCTGGATCTGCCTTATGGTCTGGAGAGGGCCATTCAGCGCATGGAGAAAGGAGAACATTCCATCGTGTACCTCAAGCCCAGCTATGCTTTTGGCAGTGTTGGGAAGGAAAAGTTCCAAATCCCACCAAATGCTGAGCTGAAATATGAATTACACCTCAAGAGTTTTGAAAAGGCCAAGGAGTCTTGGGAGATGAATTCAGAAGAGAAGCTGGAACAGAGCACCATAGTGAAAGAGCGGGGCACTGTGTACTTCAAGGAAGGTAAATACAAGCAAGCTTTACTACAGTATAAGAAGATCGTGTCTTGGCTGGAATATGAGTCTAGTTTTTCCAATGAGGAAGCACAGAAAGCACAGGCCCTTCGACTGGCCTCTCACCTCAACCTGGCCATGTGTCATCTGAAACTACAGGCCTTCTCTGCTGCCATTGAAAGCTGTAACAAGGCCCTAGAACTGGACAGCAACAACGAGAAGGGCCTCTTCCGCCGGGGAGAGGCCCACCTGGCCGTGAATGACTTTGAACTGGCACGGGCTGATTTCCAGAAGGTCCTGCAGCTCTACCCCAACAACAAAGCCGCCAAGACCCAGCTGGCTGTGTGCCAGCAGCGGATCCGAAGGCAGCTTGCCCGGGAGAAGAAGCTCTATGCCAATATGTTTGAGAGGCTGGCTGAGGAGGAGAACAAGGCCAAGGCAGAGGCTTCCTCAGGAGACCATCCCACTGACACAGAGATGAAGGAGGAGCAGAAGAGCAACACGGCAGGGAGCCAGTCTCAGGTGGAGACAGAAGCATAGCCCCTCTCCACCAGCCCTACTCCTGCGGCTGCCTGCCCCCCAGTCTCCCCACTCCACCCTGTTAGTTTTGTAAAAACTGAAGAATTTTGAGTGAATTAGACCTTTATTTTTCTATCTGGTTGGATGGTGGCTTTAGGGGAAGGGGGAAAGGTGTAGGCTGGGGGATTGAGGTGGGGAATCATTTTAGCTGGTGTCAGCCCCTCTTCCCTTCCTCCATTGCACATGAACATATGTCCATCCATATATATTCATCAGAATGTTAATTTATTTTGCTCCCTCTGTTAGGTCCATTTTCTAAGGGTAGAAGAGGCAAGTGGTAGGGATGAGGTCTGATAAGAACCCAGGGTGGAGAGGGAGACTCCTGGGCAGCCGTTTTCCTCATCCTTTCCCTCTCCCAGTCCATTTCCAAATGTGGCCTCCATGTGGGTGCTAGGGACATGGGAAAAACCACTGCTATGCCATTTCTTCTCTCTGTTCCCTTCCTCACCCCCGACGGTGTGGCTGATGATGTCTTCTGGTGTCATGGTGACCACCCCCTGTTCCCTGTTCTGGTATTTCCCCTGTCAGTTTCCCCTCTCGGCCAGGTTGTGTCCCAAAATCCCCTCAGCCTCTTCTCTGCACGTTGCTGAAGGTCCAGGCTTGCCTCAAGTTCCATGCTTGAGCAATAAAGTGGAAACAATAAAACCTGGGTGTCAGAC