Transcript asmbl_70070

Sequence
Transcript Sequence for observation asmbl_70070 of TGE0007360:
AGCAGCAGCAGCAGCAGCCGCCGCACCACCACCACCATTATTATTACTACAACCACAGCCACAACCACCATCACCACCACCATCACCAGCAGCCTCACCAATACCTGCAGCATGGAGCCGAGGGCAGCCCCAAGGCCCAGCCAAAGCCGCTGAAACATGAGCAGAAACACGCCCTCCAGCAGCACCAGGAAACGCCGAAGAAGAAAACAGGCTATGGTGAACTAAATGGTAATGCTGGAGAAAGAGAAGTATCTTTAAAGAACCTGGGTTCTGATGAAGCTACCAGCCCAATTTCCAGGGTCCTCAATGGCAACCAACAAGTTGTAGACACTAATCCGAAGCAGACTGTAAAGACCAGCACCTTTGGGAAAGCAGGAATTAAAACCAGGAATTTCATTCAGAAGAACAGTATGGACAAAAAGAATGGAAAGTCTTATGAAAATAAATCTGGAGAGAACCAGTCTGTAGATAAGAGTGATGCTGTAGCAATTCCAAATGGTGTTGTAACAAATAATTCTGGCTATATTACTAATGGTTATATGGGCAAAGGAGCAGATAATGATGGTAGTGGATCTGAGAGCGGATATACCACTCCTAAAAAAAGGAAAGCTAGGCGCAATAGTGCCAAGGGTTGTGAAAACCTTAATTTAGTGCAGGACAAAATAATGCAACAAGAGACCAGTGTCCCAACCTTAAAACAGGGACTTGAAACTTTCAAGCCTGACTATAGTGAACAAAAGGGAAATCGAGTAGATGGTTCAAAGCCCATTTGGAAGTATGAAACTGGGCCTGGAGGAACAAGTCGAGGAAAACCTTCTGTGGGTGATATGCTGCGGAAAAGTTCTGATATTAAACCTGGCGTGAGCAGCAAAAAATTTGATGACCGGCCCAAAGGAAAGCATGCTTCTGCTGTTGCCTCCAAAGAGGACTCATGGACCCTATTTAAACCACCTCCAGTTTTTCCAGTAGACAATAGCAGTGCTAAAATAGTTCCTAAAATAAGTTATGCAAGCAAAGTTAAGGAAAACCTCAACAAAACTGTACAGAACTCTTCTGTGTCACCATCTTCATCTTCATCCTCTTCATCATCTGTTGGGGAAACTCAGACCCAATCTTCAAGTCGGTTATCCCAGGTCCCTATGTCAGCGCTGAAATCTGTTACTTCAGCCAGCTTTTCTAATGGACCTGTTTTAGCAGGGACTGATGCAAGTGTGTATTCTCCAGGGGGTCAGCCACTGCTAACTACTGCTGCTAATACGCTAACACCCACCTCTTCTGGGACTGATTCAGTTCTCCAGGACATGAGTCTGACTTCAGCAGCTGTTGAACAAATTAAGTCTAGCCTTTTTATCTACCCTTCAAATATGCAAGCTGTGCTGTTGAGCACAGCACAAGTGGATCTACCCTCTCAGACAGATCAGCAAAACCTGGGGGATATCTTCCAGAATCAGTGGGGTTTATCATTTATAAATGAACCCAGTGCTGGCCCTGAGACTGTTACTGGGAAGTCATCAGATAAAGTGATGGAGGTGACATTTCAAGGGGAATATCCTGCCACTTTGGTTTCACAGGGTGCTGAAATAATCCCCTCAGGAACTGAGCATCCTGTGTTTCCCAAGGCATATGAGCTGGAAAAACGGACTAGTCCTCAAGTTCTGGGTAGCATTCTAAAATCTGGGACTACTAGTGAGAGTGGAGCCTTATCCTTGGAACCCAGTCATATAGGTGACCTGCAAAAAGCAGACACCAGTAGTCAAGGTGCTTTAGTGTTTCTCTCAAAGGACTACGAGATAGAAAATCAAAATCCTCTGGCATCTCCTACGAACACTTTGTTAGGCTCCGCCAAAGAACAGAGATACCAGAGAGGCCTAGAAAGGGATGATAGCTGGGGTTCTTTTGACCTGAGGGCTGCTATTGTATATCACACTAAAGAAATGGAATCTGTTTGGAATTTGCAGAAGCAAGATCCCAAAAGGATAATCACTTACAATGAAGCCATGGATAGTCCAGATCAATGAAGGACCAGACTGCCTATTTGTAACCTTCCTGCAGCATTAGAGCCACCGTTCATGGGGGACACAAGGCTTTTATGCTCCTAGATCTTCAACGCAGCAGAGGAACCATAAGTAGAATCACAGGATAATATATACATATATATATATACAT