Transcript asmbl_69751

Sequence
Transcript Sequence for observation asmbl_69751 of TGE0007325:
GGGGTTTGCAGCTGCTCCGTCATCGTGCGGCCCGACGCGAGCCCGCGCTCGTGTGCAGGCCCGGCTTGGTTCCTGGTCTCTGGTGCGAGGGTTCACACGAGGCCCCGGCCTCGGACCCCGGACTAGGCCGCGACCCCGGGCGCCATGAAGCAGGAGGGCTCGGCGCGGCGCCGAGGGGCGGACAAGGCGAAACCGCCACCCGGCGGAGGGGAACAAGAACCACCGCCACCCCCGGCCCCCCAGGATGTGGAGATGAAAGAGGAGGCGGTGGCAGGTGGCGGATCAACGGGGGAGGCTGACGGCAAGACGGCGGCGGCGGCGGCTGAGCACTCCCAGCGAGAGCTGGACACCGTCACCTTGGAGGATATCAAGGAGCATGTGAAACAGCTGGAGAAGGCAGTTTCAGGCAAGGAGCCTCGATTTGTTCTGAGGGCCCTGCGGATGCTGCCTTCCACATCACGCCGCCTCAACCACTATGTTCTGTATAAGGCTGTGCATGGCTTCTTCACCTCAAATAATGCCACTCGGGACTTCTTGCTACCCTTCCTGGAAGAGCCCATGGACACAGAAGCTGATTTACAGTTCCGTCCCCGAACAGGAAAAGCTGCATCAGCACCGCTGCTGCCTGAAGTGGAAGCCTATCTGCAGCTCCTCATGGTCATCTTCCTGATGAACAGCAAGCGCTACAAAGAGGCACAGAAGATCTCTGATGATCTGATGCAGAAGATCAGCACTCAGAACCGCCGGGCCCTGGACCTTGTGGCTGCAAAGTGTTACTACTACCACGCCCGGATCTATGAGTTCCTGGACAAGCTGGATGTGGTGCGCAGCTTCTTGCATGCACGGCTCCGGACAGCCACCCTTCGGCATGACGCAGACGGGCAGGCCACCCTGCTTAACCTTCTGCTGCGGAACTACCTACACTACAACTTGTACGACCAGGCTGAGAAGCTGGTGTCCAAGTCCGTGTTCCCTGAGCAGGCCAACAACAATGAGTGGGCAAGGTACCTCTACTACACAGGGCGGATCAAAGCCATCCAGTTGGAGTACTCAGAGGCCCGGAGAACAATGACCAATGCCCTTCGCAAGGCCCCTCAGCACACAGCTGTCGGCTTCAAACAGACTGTGCACAAGCTTCTTATTGTGGTGGAGCTGTTGCTGGGGGAGATCCCGGACCGACTGCAGTTCCGTCAGCCATCCCTCAAGCGCTCGCTCATGCCCTACTTCCTTTTGACCCAAGCTGTCAGGACAGGAAACCTAGCCAAGTTCAACCAGGTCCTGGATCAGTTTGGGGAGAAGTTTCAAGCAGATGGGACCTACACCCTAATCATCCGACTGCGGCACAACGTCATTAAGACAGGTGTGCGCATGATCAGTCTCTCCTATTCCCGAATCTCCCTGGCCGACATCGCCCAGAAGCTGCAACTAGATAGCCCAGAGGATGCAGAGTTCATTGTTGCCAAGGCCATCCGGGATGGCGTCATTGAGGCCAGCATCAACCATGAGAAGGGCTACGTGCAGTCCAAGGAAATGATTGATATCTATTCCACGCGTGAGCCCCAGCTCGCCTTCCACCAGCGCATCTCCTTCTGCCTAGACATCCACAACATGTCTGTCAAGGCCATGAGGTTTCCTCCCAAATCATACAACAAGGACTTGGAATCTGCAGAGGAACGGCGTGAGCGAGAGCAGCAAGACTTGGAGTTTGCCAAAGAGATGGCAGAAGATGATGATGACAGCTTCCCTTGAGCTGGGGGGCTGGGGAGGGGTGGGGTGAGTGGGGACTGGCTCTTTATCTTTCCCCTCAGGGGTCCCATGCCCAGGGAACTGGCCCTTTTTCCCACACACAGCTCACAGACTGCATATGTGCTGGGGGCGGGCGGGGTGAAGGGTGTAGAGAGCCAGCCACCCCCACCTCACCTCAGGGCCCCTCCCCAGCCGGTGATTTAGCACACAGTGGTCAAGAGGGCGGGCAGACAGCCTCCCCAGGGCAGGGTCCTGGCTAGTGGTGTGGGCAGCAAGATGGGAGGGAAAAGCCCTGTGCTCTCCTCCAGGGAGTAGGGGACTGGAACTGGGACATGTGTCGGGTTGTATGTTTTTTGAAGCTTCAATTATGATTTTTAAACAATAAAAGTTCTCCAAAGCA