Transcript asmbl_69725

Sequence
Transcript Sequence for observation asmbl_69725 of TGE0007322:
GCCCCAGTCACTGAGCCGCCGCCGAGGACTCAGCAGCCTCCCCCTTGAGCCCCCTCGCTTCCCGACGCTCCGTCCCCCCTGCCCGCCTTCTCCCGCCGCCGCCTTCCGCAGGCCGTTTCCACCGAGGAAAAGGAATCGTATCGTATGTCCGCTATCCAGAACCTCCACTCTTTCGACCCCTTTGCTGATGCAAGTAAGGGTGATGATCTGCTTCCTGCTGGCACTGAGGATTATATCCATATAAGAATTCAACAGAGAAACGGCAGGAAGACCCTTACTACTGTCCAAGGGATCGCTGATGATTACGATAAAAAGAAACTAGTGAAGGCGTTTAAGAAGAAATTTGCCTGCAATGGTACTGTAATTGAGCATCCAGAATATGGAGAAGTAATTCAGCTACAGGGTGACCAGCGCAAGAACATATGCCAGTTCCTCGTAGAGATTGGTCTGGCTAAGGACGACCAGCTGAAGGTTCATGGGTTTTAAGTGCTTTTTGGCTCACTGAAGCTTAAGTGAGGATTTCCTTGCAATGAGTAGAATTTCCCTTCTGTCCCTTGTCACAAGTTTAAAAACCTCACAGCTTGTATAATGTAACCATTTGGGGTCTGCTTTTAACTTGGACTAGTGTAACTCCTTCATGCAATAAACTGAAAAGAGCCATGCTGTCTAGTCTTGAAGTCCCTCATTTAAACAGAGGTCAAGCAGTAGGCACCCGGCAGTGTCCAGCCTGAAACAAAGCAATAACGTGATGTTTCGGCCAAGCTCAGAGCCCCAAGATCACAGATGGCTATGTCCAGCCAGAAGCTCCTCGGCTCTCCCTCTACAGAATTCCCTGCCCTAAGAGAATGTCACCACCTGAACAGCCTTCGGTGAAGCTTGAGAGAGGATGGGGTAAGGCAGCAACAGCAGCTGTGCCACTAGAGGGAGCCTCCAGTAGTCAAAGATCCCTTGGTGTCTCCAATCTGACCAGGTGGGTGGAGCTTCAGGCAGTCACCTTCCCGCTGTTGAGGTGATAAGGACACCTGGCTTGCCACCAAGGTGTTTTTGATAAGAAATGTCCTAACCGATGTCCAAACACAGAATGTGAGGCCAACCTTCTATCAGAGTTAAACTTTTGACAAGGGAACAAGTTTCAAACTGATGTGTCATGTAGCTAGCTGTAGAGCTTGCAGTTTACTAGCAAGAGCTGCCCAATGCCATGTGAAGTAACAGATTTTTGGTTTTTTCCCTTCAGTTTTAATGTTATGTAATGTATTTAAACCCTTATTTAAATAAAACTTGTTTTCAGAAACACCTGAGTTATAGATTCTATTTTATGTATAGTCAGTTGTATGTGTGAAGGAACTACAGAAATGGACAGTGG