Transcript asmbl_69701

Sequence
Transcript Sequence for observation asmbl_69701 of TGE0017388:
GCGGCGGCTTTGCTAGCGGGAGAGAGGTTGTTACGCTGGTGATTGAGGAGCGATGCCGAGGGAAATCATCACCCTACAGTTGGGCCAGTGCGGCAATCAGATTGGGTTCGAGTTTTGGAAACAGCTGTGCGCCGAGCATGGTATCAGCCCCGAAGGCATCGTGGAGGAATTTGCCACCGAGGGCACTGACCGCAAGGACGTCTTTTTCTACCAGGCAGATGATGAGCACTACATCCCCAGGGCCGTCCTGCTGGACCTGGAGCCCCGCGTGATCCACTCCATCCTCAACTCCCCCTATGCCAAGCTCTACAACCCAGAGAACATCTACCTGTCGGAGCATGGAGGAGGAGCTGGCAACAACTGGGCCAGTGGATTCTCCCAGGGAGAGAAGATCCACGAGGATATTTTTGACATCATAGACCGGGAGGCAGATGGCAGTGACAGTCTAGAGGGCTTCGTGCTGTGTCACTCCATTGCAGGGGGGACAGGCTCTGGCCTGGGCTCCTACCTCTTAGAACGGCTAAATGACAGGTACCCCAAGAAGCTGGTGCAGACATACTCAGTTTTTCCCAACCAGGATGAGATGAGCGATGTTGTGGTCCAGCCCTACAACTCATTGCTCACGCTCAAGAGGCTGACCCAGAACGCAGACTGCGTGGTGGTGCTGGACAACACAGCCCTGAACCGGATCGCTACGGACCGCCTGCACATCCAGAACCCATCCTTCTCCCAGATCAACCAGCTGGTGTCCACCATCATGTCAGCCAGCACCACCACCTTGCGCTACCCCGGCTACATGAACAACGACCTCATCGGCCTCATCGCCTCGCTCATTCCCACACCGCGGCTCCACTTCCTCATGACCGGCTACACCCCCCTCACCACAGACCAGTCGGTGGCCAGCGTGAGGAAGACCACGGTCCTGGATGTCATGAGGCGGCTGCTGCAGCCCAAGAACGTGATGGTGTCCACCGGCCGGGATCGTCAGACCAACCACTGCTACATCGCCATCCTCAACATCATCCAGGGGGAGGTGGACCCTACTCAGGTCCACAAGAGCCTGCAGAGGATCCGGGAACGGAAGTTGGCCAACTTCATCCCCTGGGGCCCAGCCAGCATCCAGGTGGCCCTGTCGAGGAAGTCTCCTTACCTGCCCTCTGCCCACCGAGTCAGCGGGCTCATGATGGCCAACCACACCAGCATCTCCTCGGTGAGGCTCACAGTTTGTAACTATTTTCCCATAATCATTTTCCCGGTTGTGCCTCACCTCTCTG