Transcript asmbl_69415

Sequence
Transcript Sequence for observation asmbl_69415 of TGE0017362:
AAACTGAACACTTTTCCAATTTTGTTTTTCTAAGAATTCAGGTATTGAAAAAGCTTTTCTCTTCGATGTTGTTAGCAAAATCTACATTGCAACAGACAGTTCTCCTGTGGATATGCAATCTTATGAACTTTGCTGTGACATGATTGATGTTGTAATTGATGTGTCTTGTATATATGGGTTAAAGGAAGATGGCAGTGGAAGTGCTTATGACAAAGAGTCTATGGCAATTATCAAGCTGAATAATACAACTGTCCTTTATTTAAAGGAAGTGACTAAATTTTTGGCACTGGTCTGCATTCTTAGGGAAGAAAGTTTTGAACGAAAAGGTTTAATAGACTACAACTTCCATTGTTTCCGAAAAGCTATTCACGAGGTTTTTGAGGTGGGTGTGACTTCTCACAGGGGCTGTGGTCACCAGACCAGTACCCCCAGCCTGAAAGCATTGACACACAACGGCACACCACGAAATGCCATCTAGCCCGAATTCCAGTGGTCGGGGCTCTGTGCCAGCTTACTCTTCCCTCCAGGGTCAGATGCCACGTGCTCCAGGACATGGGAGTTGCCGCTTGTGGGAATCTGGTACCTGCCCCACTAGAGACAAGGGGTAAAGGTTCTCATTCGGATGAAAACCCCTTCAAACAGTGGTGTACAACTGAAGCTACTATTTCTTTTCTTTTTTTATTTTTTTTAATGGCAAAAAGGAATTCTAGAGACGACAGAACTCATGTGTTTCTCCTTTTGGGGTCCTACTTTAAGTAGTTGGGATATTTTGGACCTGGAGATAACACCACTTATCCATCTTTACCAGGGGATGTTGCCATTATTTACCAGTTGAAAATAATAGAAAGAACTGAGTTTTTATATGCTTCACTTAGGTTTTCATTTGAGTAGTCTCTAAAAATCCTGCCTTGCTTAAGTTCTAACACTGCCTCTCAGATTCCAGTTTTGGACATTGCATACCTAAGACCTTTTAAATGCATTTGCTTGCTAACTCAGAAGACTCATGGTCTGACTGCAGCAAAGGACATTCCTGTTACTGAAGAAATGAGAAAATTTTATGCTGCATCAGGTCAAGGGCAAGGGTCAACAGTGGCTACATTTGTTCTTGGAAGTATTGAGGAAAAAAATTTTAAAACAGAAGAAAATTTTTGCACATGTGTTTTGGGTACCAGAGATCTGGGTTCTTTCTTTTGCATAAAGTAAATGATCATGATCAATGTAGCAAAGGGAATTGAAAAAAATTGTTTCCCCCACAATCTCCTCCTCCTAGGGGAGAAACTCATTATGTCATTGAAATATTTAGCTCATTTTTCTTTAAACTTGATACCAGCCGCTACATACTTTTTATTCTAAGCTGTCTAGATTCTTTAAGTACTGCTGTTTTTGTTGGCCATGCATGACCTGAAGGCACTGGTGGACTGTCCACTGGGAGTTGGAGAGAGCACATGGCACTACACATGTGTTGTTAAACATACTTCATCTCCAGTATTCTGACACCAAGTGTCAACTGTGGTACTTTCTTCACCTAGGATATTAATTGATAATTGTTTCTTTTCATTGATGGTTGATACCCTTTCTGTTGATTTAAACGTACACATTATTTTTACTCCACATGCCCAGTAGTCATATATTCCAAAGCCACTGGACCACTTGAGTACATAAGTGCCACTGTTTAATGAAATATGTATATTCAGGTCTGTAAACCTAACAGTGTGACTTGGAGTGCTTCTTGCAGATGACTCTGACTGCTGAGTATTTACATGGACCATGGTGATATCCAAAAGAAAAATGCTTTTATATTTATAGATTATTTCATTGAACTATATAAAATGGGTATCAATAAATGTATTTACAC