Transcript asmbl_68206

Sequence
Transcript Sequence for observation asmbl_68206 of TGE0007215:
GGGCCCGCGATTAGGTCATGGCGCTGGCCGCTCGACTCTGGCGCTTTCTCCCTTCGGGACGCGGCACTGCCGTGGGAACTCGGTTTCTGACGGGTGCTGCTGGCAGCCGCGGGACTTGCGGGCCTGGGCGACTCGGCGGCTCTGAGGTGATGGGAAACCCAGGAGCCTTTAAAAGAAGCCTCATATTCTCAGCCTTGTCTTATTTGGGTTTTGAGACTTATCAAGTCATCTCTCGGACTGCTGTGGTTCATGCCACAGCCAAAGTCTTGGGAGTTGAAGAAGTCCTTGCACAAGCAGACTACCTCTACGAAAGTGGAGAAACAGAAAAACTTTATCAGCTGCTGACCCAGTACAAGGACAGCGAAGATGCAGAGTTACTGTGGCGTTTGGCACGGGTGTCACGGGACGTAGCTCAGCTTAGCAGAACCTCGGAAGCGGAGAGAAAGCTGCTGGTGTACGAAGCCTTAGAGTACGCAAAAAGAGCTCTAGAAAAAAACGAAGCAAGCTTTGCAGCTCATAAGTGGTATGCCATCTGTATTAGCGACGTTGGAGATTACGAAGGCATCAAGGCTAAGATTGCAAACGCCTACGTTATCAAGGAGCATTTTGAGAAAGCAATCGAACTGAACCCTAAAGATGCTACTTCAATTCACCTAATGGGCATTTGGTGTTACACGTTTGCGGAAATGCCTTGGTATCAGAGGAGAATTGCTAGAATGCTGTTTGCAGCCCCGCCCAGCTCCACCTACGAGGAGGCCTTGGGCTACTTCCAAAGAGCAGAGCAAGTGGATCCGAACTTCTACAGCAAAAACTTGCTTCTCCTGGGAAAGACGTACTTGAAGCTGCACAACAGAAAGCTCGCTGCGTTCTGGCTGGTGAAAGCCAGGGACTACCCCGCACACACCGAGGAGGACAGGCAGATTCAGATGGAAGCCGCTCAGTTGCTTACAAGTTTCAGTGACAAGAATTGAGAATTTTTCAGAGAAGAAAACACATGAAATACCTAGGAACCACCACCTTTTCATCAAATTACAACATCGTTATGACAAAGAAAAAGCA