Transcript asmbl_68205

Sequence
Transcript Sequence for observation asmbl_68205 of TGE0007215:
GGGCCCGCGATTAGGTCATGGCGCTGGCCGCTCGACTCTGGCGCTTTCTCCCTTCGGGACGCGGCACTGCCGTGGGAACTCGGTTTCTGACGGGTGCTGCTGGCAGCCGCGGGACTTGCGGGCCTGGGCGACTCGGCGGCTCTGAGGTGATGGGAAACCCAGGAGCCTTTAAAAGAAGCCTCATATTCTCAGCCTTGTCTTATTTGGGTTTTGAGACTTATCAAGTCATCTCTCGGACTGCTGTGGTTCATGCCACAGCCAAAGTCTTGGGAGTTGAAGAAGTCCTTGCACAAGCAGACTACCTCTACGAAAGTGGAGAAACAGAAAAACTTTATCAGCTGCTGACCCAGTACAAGGACAGCGAAGATGCAGAGTTACTGTGGCGTTTGGCACGGGTGTCACGGGACGTAGCTCAGCTTAGCAGAACCTCGGAAGCGGAGAGAAAGCTGCTGGTGTACGAAGCCTTAGAGTACGCAAAAAGAGCTCTAGAAAAAAACGAAGCAAGCTTTGCAGCTCATAAGTGGTATGCCATCTGTATTAGCGACGTTGGAGATTACGAAGGCATCAAGGCTAAGATTGCAAACGCCTACGTTATCAAGGAGCATTTTGAGAAAGCAATCGAACTGAACCCTAAAGATGCTACTTCAATTCACCTAATGGGCATTTGGTGTTACACGTTTGCGGAAATGCCTTGGTATCAGAGGAGAATTGCTAGAATGCTGTTTGCAGCCCCGCCCAGCTCCACCTACGAGGAGGCCTTGGGCTACTTCCAAAGAGCAGAGCAAGTGGATCCGAACTTCTACAGCAAAAACTTGCTTCTCCTGGGAAAGACGTACTTGAAGCTGCACAACAGAAAGCTCGCTGCGTTCTGGCTGGTGAAAGCCAGGGACTACCCCGCACACACCGAGGAGGACAGGCAGATTCAGATGGAAGCCGCTCAGTTGCTTACAAGTTTCAGTGACAAGAATTGAGAATTTTTCAGAGAAGAAAACACATGAAATACCTAGGAACCACCACCTTTTCATCAAATTACAAGTACATTATAACTGTTCTCTGTCTGTTTTCTTGGTTCTTTTAATGTATTTCACAAATCACAAAAGAAATAATTGCCGTGAGCGTGGTCGGGCTGTCTCTGGCTCAGAGACTACTGTGCATTGGGGGCCCCAGCAGTGCAAAGTGGGATCAGATTTGAGGACTGGTCCCATCAGGCTGGGAGGGGATCAGGAAAAGCTTTGTGGGGGAGGTGGCAGTGGGGACTGCATTGCAAGCTGGATGGAGTCAAAGTTGAAATCTTGTCGAGATGGCGAGTGGCAGTCGGGAGGCTGGGAACCAAGGGATTAAGTGATGTGTCTTGGAGCCAGCCTTGTCAGGAGGACTGGGAAGGGACTTGATTTCCTTGTCCCTGTGACTCCACCTCACGGGTGGATTTGTGTCTGGACAAAGCCCAGATCTGGTGCCCTGACGGGGTGGAAGGGAAACCGTGTGGCTTACTGGGGGGGCCGTCAGCACTGCCGACTCGGAGGCTGTGAACAGGAGGACCTCAGACGCCACTTAGATCTGAGTGTACGTGTGTGTGGCCTCTCCCCAGAAGGGGCGGGAAGTGTGTCCCGGTGAACCGCGTGGGTGTGTGCTGTTCGATCATGTGTGTTTTCCAGCAAAAAGGAAGACTGGAGTCTGCACACCTGTCTGATTCACACGTGGACGTGTAGTCTCAGAATTGTAGACAACTCATTTCATCCCTACATACCTGAGCACGCACTGTCTCACAGTAAGGACATCCTTCACAAATCCGTTGTCACCGCTGAAAAGTTAACAGTAGTAGTTTCTCGAATGTCCCAAAATGTCTGTTTTTGAAACCAGGATCCAAACATCATAACGCTGCCTTCGTTTGAAATCGGAAACAGTTCCCCCACCTTTTTTCTCACAGCATTGACTTTGTGAAGAGGCTGGCACAGCTGGCTCAGATTGTCCCTTTTCTAGGTCGGCCGTACGGGACACACCTGGAGACCCCCTGCTCCGTGGCTCAGATTCCAGTGAATCGCACGTGCAGTAGATTTTCTCTAACTTACATTTATCACTTTCTGGTTTTTCTTTTTACTTTTTTCGGTTTCATTTTTTGGCTCGCTTCATTTCTGTCTCGTGTCCCTTTAGTTCTAGATCGTTT