Transcript asmbl_68142

Sequence
Transcript Sequence for observation asmbl_68142 of TGE0007200:
CGGATGCAGACGCGAGCACAGGTTTATAAGCGCCACGCAGGCCACGGTCCCTTCTTTTGGAGGAAGACGCGGTAGCAGCTTCAGCTGCGTTTCGTCTTGCTCGCTGTTGCTCCTGACTCACCGCTGTTCGCTCTCGTGGAGGAACAAGTCGGTCAGGAAGCCGCGCTGCAGCCATGGCCTTTAAAGATACCGGAAAGACGCCCGTGGAACCAGAGGTGGCGATTCACCGAATTAGAATTACTTTGACCAGCCGCAACGTAAAATCTTTGGAGAAGGTGTGTGCTGATTTGATCAGAGGTGCGAAGGACAAGAATCTCAAAGTGAAAGGACCAGTTCGGATGCCCACCAAGACTCTGAGAATCACTACAAGAAAAACTCCCTGTGGAGAAGGTTCTAAGACTTGGGATCGTTTTCAGATGAGGATCCACAAGCGACTCATTGACTTGCACAGCCCTTCTGAGATTGTTAAGCAGATTACTTCCATCAGTATTGAGCCAGGAGTTGAGGTTGAAGTCACCATTGCAGATGCTTAAATCAGACTTTTTAATAAATTGACTATCAGTTAAATTTTGTTGACTTTTATTTGCAGTAATGGCACATTTTAAGACTATAAATTTAGACTGAATTTACTTTCAAGTAGAATAATCAAAATTAGTTGGATATGCTGTGGTAACCTGTCCTGTTTTCATTATATTCTGTTGTAGAGTCTGCTAAACCAGTTTATACTTGGAATCACAGGACAGCTGGGTTCTGTTAACTAAATACATGAGACCTGACCGTTGATGAATGTATAGTGTGGTGGCTTTATAACTGGCTGCATATTGGGGCTTTTTCAAAGAATGCATGTCTGGGTCCTATCACAAGAAATTCTGACAATTGATTTGGGGTTCTGTCCTATAACACAAACAGTTTCTGGGGTGATTCTGAAGTTCTATGACTGGTTTAGAGCCTGGCGCGTTAGAGGACAAGTAACTGGGAAAACAAGTTCTACCCCTGGCTCTGCAAATAAAGTCATCCCTCCTTTTTAGAAGATACATAGCTAAAGAGTAAACAAGGCAAATTTTAACAGGTTTTGGCAACATCGGTTTTACATATATTTTAGATTAAAAGGTAAAAGTAAATACTAGTACTTTGCTGATAGGTTGTATCTAGACTTGTATTTTATATACATTACTTGGAATTTTAACAATGTGTAGGTTATTCACTATGAAATTCTTAACTTTAGGACTGAAAAGCATGTCACATAGGCCAAATTCATTCAGCAAAACTTCTGTTGGCACAGTGAATAATATTAACTACCAGGTTGTATGCTTAAATGCTTTATTTTGTTGAATTCTATTCCTATTATGTAGATCCAGAAATTGGCTTAGAGTTTTAACTTGCCCATTGTCCTAGAGCTTGAAACCATAGCTGAGATTTAAACAGGTATACAAGATGAGAATCCATCTTTTGATATCCCATTAAAGTATTGAAAAGTTTTTGCTATA