Transcript asmbl_68136

Sequence
Transcript Sequence for observation asmbl_68136 of TGE0007199:
CGCCGCCGCCGGCTTGGTTTGTGAGGAAGGGCCTAGGCCCAGGCCTGCTGTGCTGGGCTCGCTGAGCGCCGGAGCTCGCGTCCTGCTGTCACCTCTACCCCAGCTTCGCCCACAGCCCGTCCCAAACGGGCTGGGCGCAGGGGAGACCTGCCGGAGCCATGGAGGACGAGGTGGTCCGCATTGCCAAGAAGATGGACAAGATGGTGCAGAAGAAGAACGCGGCTGGAGCACTGGATTTGCTGAAGGAGCTTAAGAATATTCCCATGACCCTGGAATTATTACAGTCTACGAGAATCGGAATGTCAGTGAATGCCATTCGCAAGCAGAGTACAGATGAAGAAGTTACATCTTTAGCAAAGTCTCTCATCAAATCCTGGAAAAAGTTATTAGATGGACCATCAACTGATAAAGATCCTGAAGAAAAGAAAAAAGATACTGCAATTACATCACAGAATAGCCCAGAGGCAAGAGAAGAAAGTAGCTCCAGTGGCAATGTAAGCAGCAGAAAGGATGAGACAAATGCTCGAGATACTTACGTGTCATCTTTCCCTCGGGCACCAAGCACATCTGATTCTGTACGGTTAAAGTGTAGGGAGATGCTTGCTGCAGCTCTTCGAACAGGAGATGACTATATCGCTATCGGAGCTGATGAGGAAGAATTAGGATCTCAAATTGAGGAAGCTATATATCAAGAAATAAGGAATACAGACATGAAATACAAAAACAGAGTACGAAGTAGAATATCAAATCTTAAGGATGCAAAGAATCCAAATTTAAGGAAGAATGTACTGTGTGGGAATATTTCTCCTGACTTATTTGCTAGAATGACTGCAGAGGAAATGGCTAGTGATGAGCTCAAAGAGATGCGGAAAAACTTGACCAAAGAAGCCATCAGAGAGCATCAGATGGCCAAGACAGGTGGAACCCAGACTGACTTATTCACATGTGGCAAATGTAAAAAGAAGAATTGTACTTATACACAGGTACAGACCCGTAGTGCTGATGAACCGATGACAACATTCGTTGTCTGTAATGAATGTGGAAATCGATGGAAGTTCTGTTGAATTGGAAGAATTGGCAAAATGTCTGGACCATTAAGAAAATGGATTTTGTAATTAGCTTTAAAACTAGGCCAAGGAACTAGGTTTTCTGCAAGTCAGGTTTTTAAAGTGACATACACCCCTTGGTTAGTCTTTGTTTTTGACATAGCATCCTTCCTTAAATGCCTTCTGTAGTTTCAGATCAGTAGGGAGACTACATAATAATTGTATGGTATCCGTTTCAAACATTTCTTTTTCATTTTTATAGGTAATCGATATTAAACTTTTATCAATTAAACTTTTGGCAATTTATTTTTACCTTTTTTCCTTCTTAAAGGGAAATGTACCTTAACTTTTTTACAGTCTGAAACATACACAGTAGAAATGTTATTTTCACTTAACACATAAATGAAAATTACATTTTTTTTCCATATTGGCATGTACCTGCAAATGTTAACAGAGAAGAGAGGTAATATAATTTTAAGTTTATCAACTGTGGTGTGTATTCAAATAATACTTGAGCAGCTCAACTAAATTGTACATAATATTTGAAGTAGCATATGAAATTGGTTTTAATTATTATATTCACAAGTCTGGGATAATTAGATATTTTTTTTTATTTGTAACTAACCGTGACCATCATTTCTTGTAATTTCTTGTACATGTTATTACTTGTTCCTAATAGATTTTACTTTTGGAAACATGACTTGACTTTGTTGAAATCAGTTTGGGTTTGTTGTCTGTTTACCTGTTTGACTTCATAGTGGATTTTAGTTTTGCAGAACACTGTTTAGGTTAGTAGGCTTTTCATAAATCCCAGCACAGGCAGAGAATGAAAGCTCCTGGCAATTTTCTTCCCCTCATAAGAAGACATACTGGGAAGAAAACATTAGCATTTTAGTATAGTGTAATTATAAGTAGTTCATGACTTGATTTTGATTTGGAAATCTATACTGACCAAGGATCAAGTTTAAGGATTATATAAATTCTTTCCATATGGAGGTCGATAGAAAATATTTTTGTCCTAAGTCTAATTGGCTGACTTTTTCTGTTACACAGTGAATGAGGTTGTTGAACAAACTGAATATATGGCCTATAATGCAATTTGTTTTATAGTACAGATCTTACAATTAAGTTTTACTTTTTGTTTAAGTGTGTATCATTTGTTTTGTTAGGATAAGAAAAAAATGACTTTCACTTAGGTTCCTGAGGGCACACTTGCTCTAGTACATCTTAAAGGCCACTGTTACAAAGTTCACATTTTATCATGTTACATCTGTATTCTGTCAGATACCTACAGAAGGACCTAAGTACATGCTTTGCAGTCCCCTTTGTTCCCATATTCTCATTTGTTATTGGAAATAACTTGACGTAATACAGAGACGACATTTAAAGGTCCATGTTAAGACCCCACCTATAAGAATTGGCCCACTGGTATCATTCCACTTCTGCTTTGTCAGTTCACAGATTAATATTTTGTTTTATCATTTGAAAAATAAAGTACATTTTTGAAAGAATGAATTTTAAGAAGAATAAAATTAAAATTGTCCCACTTTTAAAT