Transcript asmbl_67773

Sequence
Transcript Sequence for observation asmbl_67773 of TGE0007193:
AGCTCAAGAGATGGCTGCCCAGTGTGTGACAAAGGTGGAGCTGAATATTTCCTGCGACAATCTTCTGGATAAAGACATAGGGTCCAAGTCGGACCCGTTATGCGTGTTATTTTTGAATACGAGCGGCCAGCAGTGGTATGAGGTTGAGCGCACAGAAAAGGTCAAGAATTGCTTGAATCCCACATTTTCCAAGACTTTCATTATTGATTACTACTTCGAAGTGGTTCAGAAATTGAAATTTGGGATTTATGACATCGACAACAAGACTATAGAGCTGGGCGATGATGACTTCTTAGGAGAATGTGAATGCACCCTTGGACAAATTGTTTCCAGTAAGAAGCTGACCCGACCCCTGGTGCTTAAGAATGGCAGACCTGCGGGGAAAGGCAGCATCACGATTTCGGCTGAAGAGATAAAGGATAACAGAGTCGTCTTGTTTGAAATGGAAGCCAGGAAACTGGATAATAAGGATCTCTTTGGGAAGTCAGATCCGTACCTGGAATTCCACAAGCAGACATCTGATGGCAACTGGCTCATGGTTCACCGGACAGAGGTTATTAAAAACAACTTGAATCCTGTTTGGAGGCCTTTTAAAATCTCCCTTAACTCCCTGTGCTATGGAGATATGGATAAGATTATCAAGGTAGAGTGCTATGACTACGATAACGATGGGTCACATGATCTCATTGGAACATTCCAAACCACCATGACGAAACTGAAAGAGGCCTCCAGGAGCTCGCCTGTTGAATTTGAATGCATAAATGAAAAGAAGAGACAGAAGAAGAAAAGCTACAAGAATTCCGGTGTCATCAGTGTGAAGCAGTGTGAGATTACAGTGGAATGCACATTCCTTGACTATATCATGGGAGGCTGTCAGCTGAATTTTACTGTGGGGGTGGACTTCACTGGCTCCAACGGTGACCCACGGTCTCCTGACTCCCTTCATTACATCAGCCCCAACGGCGTGAATGAGTACTTGACCGCCATCTGGTCTGTGGGGCTGGTCATTCAGGATTACGATGCTGATAAGATGTTTCCAGCCTTTGGGTTCGGAGCTCAGATTCCTCCTCAGTGGCAGGTGTCGCACGAATTCCCCATGAGCTTTAACCCGTCCAACCCCTACTGTAATGGAATCCAAGGCATTGTGGAGGCATATCGGGCCTGTCTTCCTCAGATAAAACTCTATGGACCAACAAATTTTTCTCCCATCATCAATCACGTGGCCAGGTTTGCTGCCGCAGCCACACAGCAGCAGACAGCTTCTCAATACTTCGTGCTGCTCATCATCACCGACGGTGTGATCACGGACCTGGACGAGACCAGACAGGCGATCGTCAGCGCCGCCAAGCTGCCCATGTCCATCATCATCGTTGGCGTCGGCGGCGCTGACTTCAGCGCCATGGAGTTTCTGGACGGTGACGGTGGGGGCCTGCGCTCCCCGTCAGGGGAGACTGCCATCAGGGACATCGTGCAGTTCGTGCCTTTCAGGCAGTTCCAGAATGCTCCCCGAGAAGCGCTGGCTCAGTGCGTCCTGGCGGAGGTCCCCCAGCAGGTGGTGGGCTACTTCAATACCTGCAAGCTCCTGCCCCCCAAGAACCGCACCGCCCAGTGAAAACGCTCCTGCGCCGCACTGCGGGCTGCCCGTTTCCCACGCTCCCCAGCATCCGTGACGGAAACCGAGTCCCCGTGGACTGCGTCTCCTTAAAGCATTCTTTTATACTTTTCTTGGAAGAAAGTGCTAACTTAACCTTTGTCCAATCAATTCAGTGATTGCTAGTGATTAGAGACTCGCACGAGGAAAGCCGCCTTTGCCATGGTGATTGTTTGCTCTCACAGGATGAAGATGCTGGTTGGAACATTCGTCAGTAGAGAGGATGAAGACTTGTTGGGGGTGGGGGAATTTCAGGCCGCTGTGCTTCGTCGGCTCGAGGCCACATGTGCTACAAGTCAGTGTCCGTCCCCGGTGACGGGCGCTTCTCAAAGCAGACGTGCTGAACCTGTCCCTGCAGTTGCTGAGTGCCTGACCCTTGCCCAAGTCTCGCTGCGGCTTAGCCACAGCACAGCTCGCCCCAGCAGCACCCCAAGACTCTCCGAAGAGCGCAGACGAGGACAGGCACCCTTGCACTTCTCAAAAGGAAGAGGAGCCTCAGGAACGTGCGCGGCTGTTCCCGTGTGCCTTTCCAGGACCCGTGTCTGCACGGAGGGCAGGCCGACCGGGCTCAGCGTCAGTAGCGTTTTTTAATTGGAGTTTGTCAGAATGGTTACGACTGCCTAGTCCAGGAAAGCTACGAGGACCAGACGTGTAGAGAAAACTGAGAATCCCTTCCCTTTTAGCCAATGAAGACTTTACTTACTAAGAAAGGACAATTTTTATCCTTGCTGAGGTCCTATACATTGATTAGTACATTTCTTCACATTCGTGTAGACATTTTTTCCTGTTTTCTTTAGTTACTCTTTTAGTCTGGTTTTTAAACTCATGATAGTGGTTGTCTATTAATCAAAATCATATTTTGCATTTTAATAATGTGCTATTTCCTAAGCCCAGAATGTACTGTATTAAGCCTAAAACCTGTTGCAACTTAAAAAAAATAGCCAACATGCTCTAAGAGCAGAATTCCCCCTTTCAGAATACATTACTCAGCAAACGCTGTCAGAACAGTCAGTAATGTTTTATTGAGGACCTGTGTGCCAGGTACCACGCATACCCACATGTTGGCCAATTATCTTGGATAATTTGACATGAAAATTTGCATGTTTGTCATGTACCCTCAAGGGGACACGCCCAGTGCCATGCCAGCATGCCTTTCGCTCTTTCTGAAACTGCGCCACGGCTCTGGTCTCTTGTTCTCTGAGATGTCTGAAGGACGCGTGAGCCTCGGCCAGGCTCCGTCTGAGAGGGGAGCTGCCTGCTGTCGTGGTCACCCAGCCAGGCGGGCAGTCACCGCCTTCCCGCTCAGTCCGCTGGTCCCTGGCTGCGCGCTGCTGACCTGAAGGCGCCTGACTGGCCGTCTGTACTCCAGGGAGCGGCTCCTTGGCCGGCAAGCCCTTCTGCTGTCAGTTAGGGGAGGGGACTGACGTCCCGCCCAAAGGCTGGGGCCTGCGCTGTCTCAAGTCCTGGTTTGGGTCCTGCGCCTGGGAACAGCACGTGCGTGCCGCTGTTTCAGAAGTTCCTTCTGCAAACACGCGAAGCCTTCTAGAAAAGGTTCCCACACGTTCCCCACGCCTGGTGAGACGCTCAGGAGCAGAGCCCTCGGTTGGGGTCGGCCGGGCTGCACGCCACTCCCCGGGCCTCCTCGTCACCCCCTCACCGCTCCTCATGCTCCTCACAGCTGTGGCCTCTGCAGGGCACTGGGGACCGCTGTCGTGGGTGCTCACTGAGGTCACTGGCCAAGCACGGTACTCTGTCACCACCATCAAATTGATTTGGTCTTCATAGTTACATCATCTGTTTTAACCAAAATTGTTCCCTTTTAAAATTAGTTTTTTGTTATTCATTCTTGATCGGGTTCATCAGTAGATGCTGTTATTCATAAGAACTGTGATTCCAGCAAATTAAGGTAATTGATACCTTTTTGCAGTTTTGAATAAACGCATTTACAATTTCTAAATAATATAAAATTCATACGATTTCGACGTTTCACCTCATTGCCTGCTGATTTAATATTGTTTTATATTAAAAGTCATTTTCCCTGTTGTGCCACCGTTCATTCAAGTGCCATTAGTTCTTAAAATGCCTTTACAGAAAACACAAGCAGTTTGCCTTCCACACCTCCCAGCATGAGACACACTGCGAACGCGTTTGGCCTGACAGCGCCCCGGGCAGAGGCACGGCTTCTCCCCTGCCCGCTGCTAGACGGTGCGCCAGCTAGCACGGCCGCGCCATCGAGCGCTTGGGACCGAAATGGTTACGGTCCCAGGTTTAGTCTCAGGGTGACACTTGTGCCCTGTGCCGTTTCTCCGCAGACTTCCCAGAGCAGATTCAGGGCCCAGTGCTGCTGACGCTTCATTCCACGCGCTGTGCCCTTTTCATTTTGTAAACTTCCCGGAAAGCCACCTTCAGTAGACGCCTCCTAATCTACGTGTGCCATCGACGGTCATGGAAGTGACACATAAGCGAGAAGTTTGGCGTTAATTGCGAGAAACTATTTTGTGCTTTTTGGATGTCATACTCGACAGTGTACAAGTTACAAATACATGAATTGATGTTGAATATATCTCCCATTTGAGATCCCTTTGGATAAAGTTATTTCTTGATGTGACACACAAGAGTGCCTTGTTCTCATTTTTTTCTCTGGTATCAAAACCAGTAGAAAAGTTAGAAATAAA