Transcript asmbl_67536

Sequence
Transcript Sequence for observation asmbl_67536 of TGE0000273:
AGGTACTAGCTTTTGACAAGTTTGCACCATGCGTGAATATAAGCTAGTCGTTCTTGGCTCAGGAGGCGTTGGAAAATCTGCTCTGACTGTACAGTTTGTTCAAGGAATTTTTGTTGAAAAATATGATCCTACGATAGAAGATTCTTATAGAAAGCAAGTTGAAGTAGATGCACAACAGTGTATGCTTGAAATTTTGGATACTGCAGGAACGGAACAATTTACAGCAATGAGGGATTTGTACATGAAAAATGGACAAGGCTTTGCGTTAGTTTATTCCATCACAGCACAGTCCACATTTAATGATTTACAAGATCTGAGAGAACAGATTCTTCGAGTTAAAGACACTGATGATGTTCCAATGATTCTGGTTGGTAATAAGTGTGACTTGGAAGATGAAAGAGTTGTAGGAAAGGAACAAGGTCAGAATCTAGCAAGACAATGGAACAACTGTGCATTCTTAGAATCCTCTGCAAAATCAAAAATAAATGTTAATGAGATCTTTTATGACCTAGTGCGGCAAATTAACAGAAAAACTCCAGTGCCTGGGAAGGCCCGCAAAAAGTCATCATGTCAGCTCCTTTAATATACTAAATGCATTGTAGCTCTGAGCCAGGTCTGAGGAATTGTTGCCCAATTCAACAGTGCCAGCATTCCAACTTTGTTAAACCTACCAACATCTTAAATGGACTTTCTGTGGTGGTACCCTTTAAGAGGCGGATGAAAGCTACTACATCAGTTTGCACATTCTAATCACTTTCCAGTATCACAAGAGAGATTTTTACTTACATAATAGTCCTAGAGTATGCAGCTGGTAAAACCAGAGGCTACAATCCAGTATTACTGCTAAGAGACATTTTTCATCCACCAATGTTGTACATGTATGAAAATGGTGTACTGTATACTTTAACACGTCCCATACTTTGTATTGGAGAGTACAATAATGTAAATCCTAAAAGCACCACTATTTTAGCATAATAAAAGAAAGTCCAAAGAGCTCCTATATAGACTACTCCAGATAACTTTGCTTCTTTGATACTTGTAGCTTATTGTAATTTTTTTTAAGAAATTCAAGGTCATTATCATTGTATTGTACAAATAAGCGCTTTGATTAACACAGCTATATAGTTTTTTTAATTTTTAAAAAACCTGTGGAGACAGTGATCTTGTCTTTAAAATATGATAGTCCTTTCAGTATAATGTCTTAGGTTAAAGACGTTGCCTTTAATATCTGTTGGGAAGGAAATGTCCAGACTTTTCAAATCTCTTATTATATGTTTCCTTTTTGTTTACATAGGGAACAATGTTTATAGTTGTGTGTACAGTGGGGGTCTACAACAAGAAGTGTATATTTTCAAACAATTTTTTAATGATTTAACAATTTTTGTAAATCATTTTCAGGCTTCTGCAGCTGTAGATTCTCACTGTGAATCCCTTGCTTGCTCATGCATAAGTGTATTTGCAATACCAAATATACAGGTTTAGTATTTTTGCCTGTTAGTGATTGTTTCACATGTGTAACGTTTTGGTTGAGATGTTAAATGGTGGACGAGTACTGTGGATGTGAATGTGGGAAGTAATTTTAATCATGTGTAATTGGTCACAAGGCCTAATTTGCAGTAACTATTGCTGTTTTATTTAACAATGCCTTGTTGCTTTGTATGCATTAACGTTTGGGTGTAAAGATTGTGTGTCTATCCAACAGGGAGCCACAGTATTTAAATTGACCAACCTAATGTTACAACTACTTTGAGGTGGCCAAATGTAAACTAAAAGCCTTAATTAAAGTGGTGCAATTTTGTATGACTTAGCATCAGTAGTTCAATAAATTTGGATTGCCATGCAAGGGCTTGCATTATAATTACTTGCCACTTGAATGTGTTTTCTGTAATGTTTAACAGTGCTAGTAAATAAATATAGGCTTAACTTTTTCAGTGTACTAGGTGCATTTTACATAGTGTGGTTTCATAATTTAACATTTGGGCAAGCCAAACTTATTAAGTACAGAAATGATGAGTGAAAGATGTCATGTTTTTATCCTAGTATTGTTTGAATATCCACATAATCACCTTTTGAGTTTTTCCTTGGCAAAGAATTTTGTAAATCAAGCAAATTACTTAAGAATATATGCCTTCTGGGTAATGTTCAGTAGCTCTGAGCATAGGAGGAGAATTAAAATACTTTGACAGATATTATGCTTATGAATTTTTAAAAGATACAGGATAAAGTTCGAATATTATGGTTACAAGCCTTTTTGAATGAGGTTGACTCAAAGTACTACTTTCTTTTTAGATAACAGATCTGCCTTTGTCTATGTGTTCTGTAATTCAGTTCTTTTTTGAAACTTGTAAACAAATCTTGACTCAAACTTTGTAAGTATTTGCCAGCCACTGGAGCATAGCAATTAATTCGTGGTAACATCTAGCTTAGGGGGCCTACTAATCCCCTAAATACATGCTATTTGAA