Transcript asmbl_6728

Sequence
Transcript Sequence for observation asmbl_6728 of TGE0007136:
CGCGGTGTCCGGTCCCAGCCTTCTCTGGGAGCGGGCGGTGGGCAACGCCGGGGTGACCCGCGCCCCTCGTTCTTGAGCCCGCGCGCTCTGAGAGGGTGCTCGGACAGATTGAAGCCATGGCTATTCTTTTTGCCGTCGTTGCCAGGGGAACCACCATCCTTGCCAAACACGCTTGGTGTGGAGGAAACTTCCTGGAGGTGACAGAGCAGATTCTGGCTAAGATACCTTCTGAAAATAACAAACTAACGTACTCACACAGCAACTATTTGTTTCATTACATCTGCCAAGACAGGATCGTGTACCTTTGTATCACTGATGATGATTTTGAACGTTCCAGAGCCTTTAATTTTCTGAATGAGATCAAGAAGAGATTCCAGACCACGTATGGTTCAAGGGCACAGACAGCACTCCCATATGCCATGAACAGTGAGTTCTCAAGTGTCTTGGCCGCACAGCTGAAGCATCATTCTGAGAATAAGGGCCTAGACAAAGTGATGGAGACTCAAGCCCAAGTGGATGAACTGAAAGGAATCATGGTCAGAAACATAGATCTGGTAGCTCAACGAGGAGAAAGATTGGAATTATTGATAGATAAAACAGAAAATCTCGTGGATTCGTCTGTCACCTTCAAAACAACCAGCAGAAACCTTGCCCGAGCCATGTGCATGAAGAATCTCAAGCTCACCATCATCATCATCGTCGTATCAATCGTGTTCATCTACATCATCGTGTCACCTCTGTGTGGTGGATTTACATGGCCCCGCTGTGTGTAAAAATAGAAAAGACAAAGTTATTCACCGGACGACACGAGAGAACAAGGAGTTAAAAGGCCGAATGATCTAAACCTTTCACTACTGACAGATGGCGTCTGCCAGTCTCTTCAGCCCTCTCTTTCTCTTTCTGTTTTTAATCCTGTTCTATGCATCCAGATTTATCTTTGTCCTCTCAGTCAGTTTATTCCAGTGTACTTCAAAATGAACCATTTATTGCAGCAGTAGCCTTAAAAAGGCTTTTGTCCGTTCCTTTGGTTTGTTCACTAGTATTATAGACTCAGAGAAACGTTTTCGTCGGTGATTGCACAAAGCCATCGCCAAGGTGGAAAACACCAGTCTTGTAAACTGCCTGCTAAAACTGTAGCTGAACATTGTACGTGCACAGAAAAGTATTCGAGAGACACGTATTGCTACCATCTCATGTTTATGTCTTTTGGTATTGAGGAGTTTTAGATGCTCGAAAACAATACGAATGGAGAATTACTGTTATTTGGGGAATTGTAATTCAATTGTTGGTGCTGCCTGCTTCTAGCAGCCCAAGCAGATAAAGTATTAGACATTCTGTCTTGGTCAGAGGGAGAATATTTTTAGAAGCACGTGGAATTATGTTCGACTTCCTAGTACTCACTTTCAGGAAGAAAGATTTGACCATTTGCAAACCTCACAGAGCTCAGTAGCTTCTGTTTCCCCGTTGCAGTTGATTTGAGAAGATAATGGTTTAAATATGGCCGAAGGTTATGGTTTTCCACATATTTCTTTGGTCCTCAGTTGATTTTTAGAGCCATTCTATAGTTAATAGAATAGACAGTGGAGGGGGTGGGGAGGCACCACAGAGGACACGCTAACGTTTTAGCTCTGTGAATGGAGGCAGCGTGGGAAGGTTTTTCCTTTCTGGGAAAAGCCCAAACAGAACATGGTCAGCTCCAGGGTTTGGGTCTGGCTGCTGTCGAATAATAATAGTCTGAGCATCCTTTGTGGTTCAGTAAGTTCTTTAATCTGCCTACTTTTGAAGAATTCTTTCGTGAAACGAGAGTAGGCACGACGATGTCTAGAAACAACGCAAGACAGTTCAGCATCCATTTAACTGCACTGTAGGAAAACTGCTGTGGATGCTTCGCTTCGGCGACTGTGACGTCTCTCTGCTGGTGTGTACTTTTGGTGTGTATCTGGAAGGACATTTACTGCTCTGGATCTAACTGCATTTATTGATCAATAAATGCCAGTAAGCAGAAATTCTATTATATTCGACTATTTTCCCAATAAAAGAACAAATCAGTCTGTAAAACCTAGCCACCTGTTTAGCCTAGTCACGTGCCTTGAATATATATGTGTCATATAACCTGGCTGATGCTACCTGTTCTTCCACGTAAACCTTTCGGTTCATTAATTGGACACGGATTTCAGGCCCACTGGAACGCTTTTCCTGGCGACCATGCATTCTACAAATGTTCTCTTTATCAACACTAATGCCTTTTAATTGCATCAGCATTTCCTACTGGAAAACACATTTGTTCCAGGAAAACATTTGCCATTCCTGAATAATAATTTCCAAATGTCTTTAATCCAAAGAAGAGGACTTAAAGTGGATTTCCCTTTCGTATACACGACTGAATAAAAATGATGTGCATGTCTTAGGGATAAATGACTTAACTGTCCCTCGATCTGTTTATGTATAAGAATGCTTTTTAAAGCACATATCTTGTTTTAAATGACGCACAAACTGAAGGCATTAATA