Transcript asmbl_6682

Sequence
Transcript Sequence for observation asmbl_6682 of TGE0007115:
CTGGGTGTTCTGCGAAGGGGTAGATCCGGTTCAGTGAGAGAATGATAAACGACTGAGAGAAGGATCAAGGAAACAACTGAGGAGAATTTAGGGGCAGGTTATGCGACGTGGAAATGGGGGCATAGGTTTCTGGGGAGGGCACACACGGAGTGGCGTCTTGCATCTCTCGGTAGATTCCAGAATCCTCCGCTATTCAGGACCGTGCAGGAAGACCATGCCGAGACCCAAGAAGAGGATGGCTGGGGCTGCTGAGCCAGACAAGAAGGGACCAGCAGGAAAACGTCCCAAGATTAAGAACCTAGGTGAGACATCAACTAAAGTGGAGAACTCCAGCCCTCAGAAGACTTCAACCTCTAAAAATTGCACGAAAAATCTAAGCAGCTATTGGCTGATGAAGTCAGAGCCAGAAAGCCGTCTAGAGAAAGGTGTAGATGTGAAGTTCAGCATTGAGGATCTCAAAGCACAGCCCAAGCAGACAGCATGCTGGGATGGTGTCCGCAACTATCAGGCTCGGAACTTCCTTAGAGCCATGAAGCTGGAGGAAGAAGCTTTCTTCTACCATAGCAACTGCAAAGAGCCAGGCATTGCCGGACTTATTAAGATTGTGAAGGAGGCTTACCCAGACCACACACAGTTTGAGAAAAGCAATCCCTATTATGATCCCTCCAGCAAAGAAGACAACCCCAAATGGGCCATGGTGGATGTACAGTTTGTTCGGATGATGAAGCGTTTCATTTCCTTGGCGGAGCTCAAAACCCATCACCAAGCTCACAAAGCCACTGGTGGCCCCTTAAAAAATATGGCACTCTTCACTCGCCAGAGACTCTCAATTCAGCCCCTGACCCAAGAAGAATTTGATTTTATTTTGAGCCTGGAGGAAAAGGAACCAAGTTAACTGATACGCTGGAATGGGCAAGACATTATTCCAAAGGAGTGAAGCTTTTATAAGACAAAAGGTGTGAGGAGGCTTGCTTGTTATGTTCATTGGGGTTTGTGTACATAGGTGGGTTTTGTGTACTTTCTCAATAAAATGCTAATATCAA