Transcript asmbl_66401

Sequence
Transcript Sequence for observation asmbl_66401 of TGE0007108:
CCGCCTCTCCAGTTATCGGCTCCTCCGAGGAAGGGGGCGGTTGGAGTGGTCTCCATTGTTCGCGGCTTAGGGCGCCATGAGGGGTGACCGAGGCCGAGGTCGCGGAGGGCGCTTTGGTTCCAGAGGAGGCCCAGGAGGAGGGTTCAGGCCCTTTGTGCCGCACATCCCGTTTGATTTCTATTTGTGCGAGATGGCCTTCCCCCGGGTCAAGCCAGCGCCTGATGAAACTTCCTTCAGTGAGGCCTTGCTGAAGAGGAATCAGGACCTTGCTCCTAATTCTGCTGAACAAGCCTCTATCCTTTCTCTGGTGACAAAAATAAACAACGTGATTGACAATTTGATTGTGGCTCCAGGGACATTTGAAGTGCAAATTGAAGAAGTTCGACAGGTGGGATCTTATAAAAAGGGAACGATGACCACGGGGCACAACGTGGCCGACCTGGTGGTAATCCTAAAGATTCTGCCAACGTTGGAAGCTGTCGCTGCCCTAGGGAACAAAGTCGTGGAGAGCCTCAGAGCGCAGGACCCTTCTGAAGTTTTGACCATGCTGACCAACGAAACTGGCTTCGAGATCAGCTCGTCTGACGCGACGGTGAAGATCCTCATCACGACAGTGCCGCCCAACCTCCGGAAACTGGACCCAGAACTCCACTTGGACATCAAGGTGTTGCAGAGTGCCCTAGCAGCCATCCGGCACGCCCGCTGGTTTGAGGAAAATGCCTCTCAGTCCACAGTTAAAGTTCTCATCAGACTGCTGAAGGACCTGAGGATTCGTTTTCCTGGCTTTGAGCCCCTCACACCCTGGATCCTCGACCTACTCGGGCACTATGCCGTGATGAACAACCCCACCAGACAGCCTTTGGCCCTAAACGTGGCATACAGGCGCTGCTTGCAGATCCTGGCCGCAGGACTGTTCCTGCCAGGGTCGATGGGCATCACGGACCCCTGTGAGAGTGGCAACTTCAGAGTACACACAGTCATGACTCTGGAACAGCAGGACATGGTCTGCTACACGGCTCAGACGCTGGTCCGGATACTCTCGCATGGTGGCTTCAGGAAGATCCTTGGCCAGGAGGGTGATGCCAGCTATCTTGCTTCTGAAATATCTACCTGGGATGGAGTGATAGTGACACCTTCAGAAAAGGCTTATGAGAAGCCACCAGAGAAGAAGGAAGGAGAAGAAGAGGAGGAGAATGCAGAAGAACCACCTCCGGGAGAGGAGGAGGAAAGCATGGAGACGCAGGAGTGACCTTGCCTTCACCCTCTTTCTTACCCAAGGGGAAGGAAGACCGGAGCCTAGGCTAACTGCCACTGGGCTTTATATGGTGGCATTTCTGAGGGATGGGGAGACGGGGGAAAAAAAACTCTATGGAAGGAAGTGTCGTCCCACAGACTTCTGCCGTTGGCCTAGTAGCCAGAAGTCCCCCAGTGAAGCAGGATACCAACTTTTCTTCCTTAATACTGTAAACTCCCCAGCTTCCAGAAACCTCTCAACCAGTACTTTGTTGTTGAAATGTGAACTGTTGATGTCTGGAAATTTTTTTCTAGGAAAAATGATTAAAGTACTTCCTAG