Transcript asmbl_66216

Sequence
Transcript Sequence for observation asmbl_66216 of TGE0007081:
TTTCCCTTAAATATTTTTGTTTTCTAAGGAAGAGGACTTTAAAAAGATTCTTCGCCTCCACTGATAACTCTGGATATGTCTCTGCTTGCTACTAATTCTGTGTCCACCAGTGATCCATCCCAGTATTCTACCTTGTAAATACTGTTATTTGTATATACTGTAAATGATGACATCGGTGGGCACTAACCGAGCCCGGGGAAACTGGGAACAGCCTCAAAACCAAAACCAGACACAGCACAAGCAGCGGCCACAGGCCACTGCAGAACAAATTCGACTTGCACAGATGATTTCGGACCATAACGATGCTGACTTTGAGGAAAAAGTGAAACAATTGATTGATATCACAGGCAAGAACCAGGATGAATGTGTCATTGCTTTGCATGACTGCAATGGAGATGTCAACAGAGCCATCAATGTACTGCTGGAAGGAAACCCAGATACGCATTCCTGGGAGATGGTCGGGAAGAAGAAGGGAGTTTCAGGACAGAAGGATGGTGGCCAGACGGAGTCCAACGAGGAAGGCAAAGAAAATCGAGACCGGGACAGAGACTATAGTCGGCGACGTGGTGGGCCACCAAGACGTGGGCGAGGTGCCAGCCGTGGACGAGAGTTTCGGGGTCAGGAAAATGGATTGGATGGCACCAAGAGTGGAGGGCCTTCTGGAAGAGGCACAGAAAGAGGGCGAAGAGGTCGCGGACGAGGCAGAGGTGGCTCCGGTAGGCGGGGAGGAAGGTTTTCTGCTCAAGGAATGGGAACCTTTAACCCAGCCGATTATGCAGAGCCAGCCAATACTGAAGATAACTATGGCAATAATAGCGGCAATACGTGGAACAACACTGGCCACTTCGAGCCAGATGATGGGACGAGACTTGATTTCATTGGGGTTGAGGGGTCAAATTATCCCCGAAAATTTGAGACTGCTCCTGGTGCGTGGAGGACTGCAACCGAGGAGTGGGGAACTGAAGATTGGAATGAAGATCTTTCTGAGACCAAGATCTTCACTGCCTCTAATGTGTCTTCAGTGCCTCTGCCTGCAGAGAATGTGACAATCACTGCTGGTCAGAGAATTGACCTTGCTGTTCTACTGGGGAAGACACCGTCTTCAATGGAGAATGATTCCTCTAATCTGGATCCATCTCAGGCTCCTTCTCTTGCCCAGCCTCTGGTTTTCAGTAACTCGAAGCAGAGCACCATATCACAGCCTGCTTCAGGGAGCACGTTTTCTCATCACAGTATGGTGAGCATGTTAGGGAAAGGATTTGGTGATGTCGGCGAAGCTAAAGGCGGCAGCACCACGGGCTCCCAGTTCTTGGAGCAGTTCAAGACTGCGCAGGCCCTGGCTCAGCTGGCCGCCCAGCATTCCCAGTCCGGAACCGCCACCACCTCCTCTTGGGACCTGGGCTCCACCACGCAGTCCCCTTCGCTGGTGCAGTACGATTTAAAGAACCCAAATGATTCAACAGTGCACAGCCCCTTCACAAAGCGCCAGGCTTTCACCCCATCTTCAACCATGATGGAGGTGTTCCTTCAGGAGAAGCCACCTGCAGCAGCTACCTCCACAGCTGCACCTGCACCCCCCTCTTCTCCGCTGCCAAGCAAACCTGCCTCGGCGCCACAAATGTCCCCTGGGTCTTCAGACAACCAGTCCTCCAGCCCTCAGCCGGCTCAGCAAAAACTGAAGCAGCAGAAGAAAAAAGCCTCCTTGACTTCTAAGATTCCTGCTCTGGCTGTGGAGATGCCTGGCTCGGCAGATATCTCAGGGCTAAACCTGCAGTTCGGGGCCTTGCAGTTTGGGTCGGAGCCTGTCCTTTCTGATTACGAGTCCACCCCCACCACGAGCGCCTCTTCAAGCCAGGCTCCGAGTAGCCTCTATACCAGCACGGCCAGCGAGTCTTCGTCCACAACGTCATCCAACCAGAGCCAGGAGTCCGGGTATCAGAGTGGCCCAATTCAGTCAACAACCTATACCTCCCAAAACAGTGCTCAGGGCCCTCTGTATGAACAGAGATCCACACAGACTCGGCGGTACCCCAGCTCCATCTCTTCATCACCCCAAAAGGACCTGACTCAGGCAAAGAATGGCTTCAGTTCTGTGCAGGCCACGCAGTTACAGACCACGCAATCTGTCGAAGGTGCTACAGGCTCTGCCGTGAAATCTGACTCACCTTCCACTTCTAGCATCCCCCCACTCAGCGAAACGGTCTCTGCAGCCTCCTTACTGACGACGACCAATCAGCACTCGTCCTCCCTGGGTGGCTTGAGCCACAGTGAGGAGATTCCAAATACTGCCACCACACAACACAGCAGCACGTTGTCCACGCAGCAGAACTCCCTGTCCACATCAGCATCTTCCGGGCGCACTTCGACGTCCACTCTTCTGCACACGAGCGTGGAGAGTGAGGCGAATCTCCATTCTTCCTCCAGCACTTTCTCCACCACGTCCAGCACGGTCTCTGCACCCCCCGCAGCGGTCAGCGTCTCCTCCGGTCTCAGTAGTGGCAGTAGCCTGGGCCTCAGCCTCGGCAGCAGCTCCACCGTCACGGCCTCGACACGAAGCTCAGTTGCCACGACTTCAGGAAAAGCTCCTCCTAACCTCCCGCCTGGGGTCCCGCCGTTGTTGCCTAATCCGTACATCATGGCTCCGGGGCTGTTACATGCCTACCCGCCCCAAGTGTATGGTTATGACGACTTGCAGATGCTTCAGACGAGATTTCCGTTGGATTACTACAGCATCCCGTTTCCCACGCCCACCACGCCGCTGACTGGGAGGGACGGTAGCCTGGCCAGCAACCCTTATTCCGGTGACCTCACAAAGTTCGGCCGCGGGGATGCCTCCTCCCCGGCCCCGGCCACAACCTTGGCCCAGCCCCAGCAGAACCAGACGCAGACACACCACACCACACAGCAGACGTTCCTGAACCCGGCGCTGCCTCCCGGCTACAGCTACACCAGCCTGCCGTACTACACAGGGGTGCCGGGGCTCCCCAGCACCTTCCAGTACGGGCCTGCCGTGTTCCCTGTGGCTCCTACCTCTTCTAAGCAGCATGGCGTGAACGTCAGCGTGAATGCATCGGCCACCCCCTTCCAGCAGCCAAGCGGGTACGGGTCTCACGGATACAACACTGGAAGAAAATATCCACCCCCTTACAAGCATTTCTGGACGGCAGAGAGCTAATTTGGCCCAAGGCTGGGGGCTGTGTTTTGTGTGTGTGTATGTTTGCACTGAAGTCTTGTTTCAGAAACCAGAGCACTGAGGAGAGCCTGCCGAGCTGTGGCCACGGCCTGCGTGGCTTGGGGAAATGAGTTGGTGGATGCCTTCTGGGCTCTTGAACTTGCCCGTCCCCCGCTTCCCCTCCTCCATGTGTCTGACCCTGTCTTACCCATTTCGAGTCCGAGCGGTGCAGCACCTCCGAAGCATCGATGCACACACACCCGCTGTTGCTTTTAATTTCTGGAAGGCATGTGGTTGCAACTTGTAACAAAAACCTTTGTAGTCTTCAATAAACTGTGGTGTTTCTTTA