Transcript asmbl_66180

Sequence
Transcript Sequence for observation asmbl_66180 of TGE0007072:
CGGGGCCAGGGTCCAGAAGTAAAGGGCTAGGGGTGTGTGTATGGGGGTGACCTGGGGAGCTGCCACCGTGTATCTGCCTTTGGTGCTTGCCCCTGCAGGGAGTGCTGGGTGCTTCCTCCCTATGCCACCCCCACATGATGCCCCTGTCCCGCTGGCTGAGGTCTGTGGGGGTCTTCTTGCTGCCAGCCCCCTGCTGGGTACCCCGGGAGAGGTGGCTGGGTACCCTGCGGCGGCCCTCCCTGGTGTATGGGGGCTCAGTCCTGGGGGCCTGGCACAGTGCCGGCTGCTGGTGCCAAGCGTGGACAGAGGAGCCTCGGGCACATTACTCCTCCCTCAGAATGAATGGAGATCAGAAATCGGATGCTTTCATGCAAGAAAAGCAGAATTTCCTCCAGTGTTTCCCAGTGATCATCAAGGTGCTGACCGATGACTTGGAACACCCAGAGATAAAGGAAGTTCTTGCCCGGCTCAAGCAGGTCCTGGAGTACAATGTCATCGGTGGCAAGCATCAGCGGGGTCTGCTGGTGCTGATCGCGTTCCGGGCGCTGGTCGAGCCGAGAAAGCAGGACGCCGCGAGTGTGCATCGGGCCCTGGTGGTGGGCTGGTGCGTGGAGATGCTCCAGACCTTCTTTCTGGTGCTAGACGACATCATGGACTCATCCATCACCCGACGGGGGCAGCTCTGCTGGTATCGGAAGCCAGGCGTTGGCTTGGATGCCATCAACGACGGTCTTCTCATCGAAACGTGTATCTACCGCCTGCTAAAGCACTACTGCCGGGAGCAGCCCTATTACCTGAACCTGATGGAGCTCTTCCTGCAGAGTTCCTACGTGACAGAGATTGGACAGAGCCTGGACCTCATCGCAGGCCTCCAGGACAAGGTGGATCTCTCAGGATTCACTGAAAAGAGGTACAAGACTATCGTCAAGTACAAGACAGCTTTCTACACTGCCTACCTTCCCGTGGCTGCAGGCATGTACATGGCGGGCATCGATGGGGAGAGGGAGCATGCCACCGCCAAGAAGATCCTGTTCGAGATAGGGGAGTTCTTCCAGATCCAGGACGATTACCTTGATGCCTTTGGGGACCCCAGTGTGACAGGCAAGATTGGCACTGACATCCAGGACAACAAATGCAGCTGGCTGGTGGTTCAGTGTCTGCAGAGGGCCTCCCCGGAGCAGCGCCAGGTCCTGCAGGAGAACTATGGGCAGAAGGAAGCCGAGAAGGTGGCCCGGGTGAAGGCGCTCTACGAGGAGCTGGACCTGCCGGGCGTGTTCTCGCGGTACGAGGAGGACAGCTACCGCCGCATCACGGGGCTCATCGGGGACCTCGCCCCGCCCCTGCCCCCTTCCATCTTCCTGGAGCTGGCACACCACTTCTACAAGCGCAAGAAATGAACTGGAGTGTGGCGCGGGGGGGCCCAATAAACGACACAAGTCCTCGC