Transcript asmbl_66157

Sequence
Transcript Sequence for observation asmbl_66157 of TGE0007064:
CGGAGATCTCAGAGGCGCCAGCTGGGAGGACCTATTAGAGCGATTGCCCAGACGCCGGTGACTCAGTGTTCGCGGGAGCGCCGCAGCCACACCAGCCAACCCGGATCCTAGGTCTGACAGCGCCGGCCCGGGTCCCCGCCTGCCAGGAGTAAGCCGACAGGCGGCCGGCCCCGCGTGTCCGACCCAGAGCCACCTCTGTCCTTCGACCCGAGCTCCGCGCCCTTCCTGCGATCCCTGCCCCGCGGGCAGCGCTGCCATCCTGCCGGCCATGGAGACTCCGTCCCAGCGGCGCGCCACCCGCAGCGGGGCGCAGACCAGCTCCACCCCGCTGTCGCCGACCCGCATCACCCGGCTGCAGGAGAAGGAGGACCTGCAGGAGCTCAACGACCGCTTGGCGGTCTACATCGACCGTGTGCGCTCTCTGGAGACGGAGAACGCGGGTCTGCGCCTTCGCATCACCGAGTCCGAGGAGGTGGTCAGCCGCGAGGTGTCCGGCATCAAGGCCGCCTACGAGGCCGAGCTCAGCGATGCCCGCAAGACCCTCGACTCGGTGGCCAAGGAGCGCGCCCGCCTGCAGCTGGAGCTGAGCAAAGTGCGCGAGGAGTTTAAGGAGCTCAAAGCGCGCAATACCAAGAAGGAGGGTGACCTGATGGCCGCCCAGGCCCGGCTCAAGGACCTGGAGGCTCTGCTCAACTCTAAGGAGGCCGCACTGAGCACGGCCCTCAGCGAGAAGCGCACGCTGGAGGGCGAGCTGCATGACCTGCGGGGCCAAGTGGCCAAGCTCGAGGCAGCCCTGGGGGAGGCCAAGAAGCAGCTTCAGGACGAAATGCTGCGGCGGGTCGATGCCGAGAACAGGCTGCAGACCCTGAAGGAGGAGCTAGACTTCCAGAAGAACATCTACAGCGAGGAGCTGCGTGAGACCAAGCGCCGCCACGAGACCCGGCTGGTGGAGATTGACAACGGCAAGCAGCGGGAGTTTGAGAGCCGGCTGGCCGACGCCCTGCAGGAGCTGCGGGCCCAGCACGAGGACCAGGTGGATCAGTACAAGAAGGAGCTGGAGAAGACCTACTCTGCCAAGCTGGACAACGCCAGGCAGTCGGCCGAGAGGAACAGCAACCTGGTGGGGGCCGCCCACGAGGAGCTGCAGCAGTCCCGCATCCGCATAGACAGCCTGTCCGCCCAGCTCAGCCAGCTGCAGAAGCAGCTGGCAGCCAAGGAGGCGAAGCTGCGGGACCTGGAGGACTCGCTGGCCCGCGAGCGTGACACCAGCCGGCGGCTGCTGGCGGAGAAGGAGCGGGAGATGGCGGAGATGCGGGCGCGGATGCAGCAGCAGCTGGACGAGTACCAGGAGCTGCTGGACATCAAGCTGGCGCTGGACATGGAGATCCACGCCTACCGCAAGCTGCTGGAGGGCGAGGAGGAGAGGCTCCGCCTGTCCCCCAGCCCCACCTCGCAGCGCAGCCGAGGCCGTGCCTCCTCCCACTCGTCCCAGACGCAGAGTGGGGGCAGCGCCACCAAGAAGCGGAAGCTGGAGGCCGCCGAGAGCCGTAGCAGCTTCTCCCAGCACGCGCGCACCAGCGGGCGCGTGGCGGTGGAGGAGGTGGACGAGGACGGCAAGTTCGTGCGGCTGCGCAACAAATCCAGCGAGGACCAGACCATGGGCAACTGGCAGATCAAGCGCCAGAACGGAGATGACCCCTTGCTGACCTACCGCTTCCCACCGAAGTTCACCCTGAAGGCCGGGCAGGTGGTGACGATCTGGGCTGCAGGAGCTGGGGCCACCCACAGCCCCCCGACCGACCTGGTGTGGAAGGCACAGAACACCTGGGGCTGTGGCAACAGCCTGCGCACGGCCCTCATCAACTCCACCGGGGAGGAGGTGGCCATGCGCAAGCTGGTGCGCTCGGTGACTGTGGTCGAGGATGACGAAGACGAGGATGGAGATGACATGATCCATCACCACCACGTGAGTGGCAGCCGCCGCTGAGGCCACGCCCACACCCACACCCACACCGGGCGCCAGCCAGGCCCGGCCGCCTCGCCCAGCCTCCCCACACAAAATCTTGTCATTAAAGAGTGTTTTGGAACTTGACTTGCTGCCCTGGCTCTTCTTCTCTCTCCTCCCCATAC