Transcript asmbl_64981

Sequence
Transcript Sequence for observation asmbl_64981 of TGE0007022:
CTTGGTCTGCAGCCGCTGCTGCCACCTCTTACCAGCGCCGTTGCTGCGGGGGATTGTGGGATCCTTCGCGTCCTGTTCGCTAGGAGAGAGGTACCTCTCCTTTTCCCTTTCCCTTTCCTTAAGAGTTGTCTGCTGGTTCTCAGCTTGAAGAAGATTCTACAGTCCTTATTGATCCTTTTTCTTGGCGTTACCATTTTTTTGAAGCAAAGTTGACCTAGTTTTGTAGTTTGAGCTTTCTTTTTGGCCATCTTTTAAGAAAATTTTTTTGGTAATCTATAAATTAGCCAAGAGATAGTTCTACAATGTCCAAGTCATTCCAGCAGTCATCTCTCGGTAGGGACTCGCAGGGTCATGGGCGTGACCTGTCTTATAGGCCTTCTTGCTGCTGCTACCCAGTCTTTAAGTATGCCAGCATCTCTTGGAAGGATGAACCAGGGTACTGCACGCCTTGCTAGTTTAATGAATCTTGGAATGAGTTCTTCATTGAATCAACAAGGAGCTCATAGTGCACTGTCTTCTGCTAGTACTTCTTCCCATAATTTGCAGTCTATATTTAACATTGGAAGTAGAGGTCCACTCCCTTTGTCTTCTCAACACCGTGGAGATGCAGACCAGGCCAGTAACATTTTGGCCAGCTTTGGTCTGTCTGCTAGAGACTTAGATGAACTGAGTCGTTATCCAGAGGACAAGATTACTCCTGAGAATTTGCCCCAAATCCTTCTACAGCTTAAAAGGAGGAGAACTGAAGAAGGCCCTACATTGAGTTATGGTAGAGATGGCAGATCTGCTACACGGGAGCCACCATACAGAGTACCTAGGGATGATTGGGAAGAAAAAAGGCACTTTAGAAGAGATAGTTTTGATGATCGTGGTCCTAGTCTCAACCCAGTGCTTGATTATGACCATGGAAGTCGTTCTCAAGAATCTGGTTATTATGACAGAATGGATTATGAAGATGACAGATTAAGAGATGGAGAAAGGTGTAGGGATGATTCTTTTTTTGGTGAGACCTCGCATAACTATCATAAATTTGACAGTGAGTATGAGAGAATGGGACGTGGTCCTGGCCCCTTACAAGAGAGATCTCTCTTTGAGAAAAAGAGGGGCGCTCCTCCAAGTAGCAATATTGAAGACTTCCATGGACTCTTACCGAAGGGTTATCCCCATCTGTGCTCTATATGTGATTTGCCAGTTCATTCTAATAAGGAGTGGAGTCAACATATCAATGGAGCAAGTCACAGTCGTCGATGCCAGCTTCTTCTTGAAATCTACCCAGAATGGAATCCTGACAATGATACAGGACACACAATGGGTGATCCGTTCATGTTGCAGCAGTCTACAAACCCAGCACCAGGAATTCTGGGACCTCCACCTCCCTCGTTTCATCTTGGGGGACCAGCAGTTGGACCAAGAGGAAATCTAGGTGCTGGAAATGGGAACCTGCAAGGACCAAGACACATGCAGAAAGGCAGAGTGGAAACTAGCCGAGTTGTTCACATCATGGATTTTCAGCGAGGGAAAAACTTAAGATATCAATTATTACAGCTGGTGGAACCATTTGGAGTAATTTCCAATCATCTGATTTTAAATAAAATCAATGAGGCATTTATTGAAATGGCAACCACAGAGGATGCTCAGGCTGCAGTGGATTACTATACAACCACACCAGCATTAGTATTTGGCAAGCCAGTGAGAGTTCATTTATCCCAGAAGTATAAAAGAATAAAGAAACCTGAAGGGAAGCCAGATCAGAAGTTTGATCAAAAGCAAGAGCTTGGACGAGTGATACATCTCAGCAATTTACCTCATTCTGGATATTCTGACAGTGCTGTCCTTAAGCTTGCTGAGCCTTATGGGAAAATAAAGAATTATATACTGATGAGGATGAAAAGTCAGGCATTTATAGAGATGGAGACCAGAGAAGATGCAATGGCAATGGTTGACCACTGTTTGAAAAAGGCCCTTTGGTTCCAGGGGAGATGTGTGAAAGTTGACCTGTCTGAAAAATATAAAAAATTGGTACTAAGGATTCCCAACAGAGGCATTGACTTACTGAAAAAAGATAAATCCCGAAAAAGATCTTATTCTCCAGATGGCAAAGAATCTCCTAGTGATAAGAAATCCAAAACTGATGGTTCTCAGAAGACTGAAAGTACAAATGAAGGTAAAGAACAAGAAGAGAAGTCAGGTGAAGATGGTGAAAAAGATACAAAGGATGACCAGACAGAACAAGAACCTAGCATGCTTCTTGAATCCGAAGATGAATTACTCGTAGATGAAGAAGAAGCAGCAGCACTGCTAGAAAGTGGCAGTTCAGTGGGAGATGAAACAGATCTTGCTAATTTAGGTGATGTGACTTCTGATGGGAAAAAGGAACCTTCAGACAAAGCTGTGAAAAAAGATGGAAGTGCTTCAGCAGCTGCAAAGAAAAAGCTTAAAAAGGTGGACAAGATCGAGGAACTTGATCAAGAAAATGAAGCAGCGTTGGAAAATGGAATTAAAAATGAGGAAAATACAGAACCAGGCGCTGAATCTGCTGAGAATGCTGATGATCCCAACAAAGATACAAGTGAAAATGCAGATGGCCAAAGTGACGAAAACAAGGAGGACTATACAATCCCAGATGAGTATAGAATTGGACCGTATCAGCCCAATGTTCCTGTTGGTATAGACTATGTGATACCTAAAACAGGGTTTTACTGTAAGCTGTGTTCACTCTTTTATACAAATGAAGAAGTTGCAAAGAATACTCATTGCAGCAGCCTTCCTCATTATCAGAAATTAAAGAAATTTCTGAATAAATTGGCAGAAGAACGCAGGCAGAAGAAGGAAGCTTAAGATGTACAAGAATCTTAATGATTTCAAAAGAAAATAATGGTTCTTTGTTTTTAATGTTAACTTTTTTAAAATACAATACTGATAGTTAGAAGAAAACTATTGTACTCTTTTGTTTTAGTGGAAAAATAATAGATGTCTGTTCATGTGTTAAGTGTTATAGCAAAAATGCATATACGGTTAAGTTAATGAAAAATTGTTTTTGTTTTATCGAAATGGTAACAGACAGAAGTACTTGTAGAGACTGACTTCGTAAACTACTTAAGACAACTTGCACCACTAAGAAAAAGATACGTAGAACTATTCAAAGAAATGAAATTTAGTAGTTCTAAGCTTCAAAGAAATGTCAAAACTTTTGATTCCATTCAATAAAGAACAAAACCAATTGTATTTTTATTACTTTCATCTGAAACATTCCACATTTTAATCTGAGCCTTGTAGACTTCTCATTTGGAGTTTGAAGCTTTTTTGGTTACATTTCATTTTCGGAGAACTTCATTAATGTGTGATTAGCAATTAAAATGCAGGTGCAGTTTTCTTTTAATGTTATGCTGTTGCTTAGGTAATAAGAAATATTAAGTAATTGGCTTTAGATTTTGTAATTTTTTCCCCTAAGTTCCTGCTAGATTTCGTATTCTAGTAGTCAATGTATTTTCAGTGAAATGTAAAAATACTCCCATTCTCTTTGACCAGTATTAATTTCTTGAAACCTTATTGCTTGTCACTTGAATCCTATAGCTGTCATACATCTGGTATAAGCAACATTTGATTTTTGAAGTGTGTAGACCATCTCTTCATATTTTCAAGATGTAATTTTACATTTCTGCATTTTAAAAAGTTTGGCCATAAGCTAGACGCACGCTTCTAATTCATATACCTGCACATGTGATCTTTGTGAACAGAAATTTGCATGTATAATCTGTGTTTACTTGTAACTTTCTGGTTATATACTGCTTATATCTGTGGATTCAAGTTTCTGAAGTGAATACCAATAAAAAAAAAACCTAGGCCATGTTCATTGGTTATACATGTTTGGAATGTTAACCAATATATTGTCAGTTGTGGTTTTTATTCACTGTTACACTTTTGCATGCTTTAACAAATTTTTACATTTTCAATCTAGAGTGTTCTGAAGATTGCTACTAAAGATATGAATTTTAAAGTTTTTGGTGCTGGTGGATTTCTTGTTCCTGTTACATAACAAAAGTGGGACTATTGGTTTTTTTAAACCTCAGGAGTTATAAATGCTAAAGACAAATAGCAAATGCTAATGTTTAGACATGTCGAAGTAGTTAACAGTAAAATTGAAAGTAACATGGTGGAATAGTAAGAATTCTAGCAGCCTTTCAAAATGTTGGGGGTCTTAGTATAAGGGAGTATCAGTTCTCAAATTTTTTTTAATTTAATAAGAACTTACAGGAATTCTTTTTGAAACTCTTAGTTCCAAGTGTATTAAAGGATATTTCAAATATTTCAATAAAATTTTATGGTATACCTCTGCAGGTCATGATATTTTTTAATGTAACATGAACAAAAAAATTTTGCCAGTTTCTTCAGTTTAATTTTGGCCTATACTAATTACCCACTTTTGTTTAATTCCAACTTTTAACTAAC