Transcript asmbl_13855

Sequence
Transcript Sequence for observation asmbl_13855 of TGE0000214:
CCGCCACTTCCCAGGTAGCCCAGCAGCCTCCAGCCGCTGCCGCCCCTGGGGAACAGGCCGTCGCGGGCCCTGCCCCCTCGACTGTCCCCAGCAGTACCAGCAAAGACCGCCCAGTGTCCCAGCCTAGCCTTGTGGGGAGCAAAGAGGAGCCGCCGCCGGCGAGAAGTGGCAGCGGCGGCGGCAGCGCCAAGGAGCCACAGGAGGAACGGAGCCAGCAGCAGGATGATATCGAAGAGCTGGAGACCAAGGCCGTGGGAATGTCTAACGATGGCCGCTTTCTCAAGTTTGACATCGAAATCGGCAGAGGCTCCTTTAAGACGGTCTACAAAGGTCTGGACACTGAAACCACCGTGGAAGTCGCCTGGTGTGAACTGCAGGATCGAAAATTAACAAAGTCTGAGAGGCAGAGATTTAAAGAAGAAGCTGAAATGTTAAAAGGTCTTCAGCATCCCAATATTGTTAGATTTTATGATTCCTGGGAATCCACAGTAAAAGGAAAGAAGTGCATTGTTTTGGTGACTGAACTTATGACGTCTGGAACACTTAAAACGTATCTGAAAAGGTTTAAAGTGATGAAGATCAAAGTTCTAAGAAGCTGGTGCCGTCAGATCCTTAAAGGTCTTCAGTTTCTTCATACTCGAACTCCACCTATCATTCACCGCGATCTTAAATGTGACAACATCTTTATCACCGGCCCTACTGGCTCAGTCAAGATTGGAGACCTCGGTCTGGCAACCCTGAAGCGGGCTTCTTTTGCCAAGAGTGTGATAGGTACCCCAGAGTTCATGGCCCCTGAGATGTATGAGGAGAAATATGATGAATCCGTTGACGTTTATGCTTTTGGGATGTGCATGCTTGAGATGGCTACATCTGAATATCCTTACTCGGAGTGCCAAAATGCTGCACAGATCTACCGTCGCGTGACCAGTGGGGTGAAGCCAGCCAGTTTTGACAAAGTAGCAATTCCTGAAGTGAAGGAAATTATTGAAGGATGCATACGACAAAACAAAGATGAAAGATATTCCATCAAAGACCTTTTGAACCATGCCTTCTTCCAAGAGGAAACAGGAGTACGGGTAGAATTAGCAGAAGAAGATGATGGAGAAAAAATAGCCATAAAATTATGGCTACGTATTGAAGATATTAAGAAATTAAAGGGAAAATACAAAGATAATGAAGCTATTGAGTTTTCTTTTGATTTAGAGAGAGATGTCCCAGAAGATGTTGCACAAGAAATGGTAGAGTCTGGGTATGTCTGTGAAGGTGATCACAAGACCATGGCTAAAGCTATCAAAGACAGAGTATCATTAATTAAGAGGAAACGAGAGCAGCGGCAGTTGGTACGGGAGGAGCAAGAAAAAAAAAAGCAGGAAGAGAGCAGTCTCAAACAGCAGGTAGAACAATCCAGTGCTTCCCAGACAGGAATCAAGCAGCTCCCTTCTGCTAGCACCGGCATACCTACTGCTTCTACCACTTCAGCTTCAGTTTCTACACAAGTAGAACCTGAAGAACCTGAGGCAGATCAACATCAACAACTACAGTACCAGCAACCCAGTATATCTGTGTTATCTGATGGGACGGTTGACAGTGGTCAGGGATCCTCTGTCTTCACAGAATCTCGAGTGAGCAGCCAACAGACAGTTTCATATGGTTCCCAACATGAACAGGCACATTCTACAGGCACAGTCCCAGGGCATATACCTTCTACTGTCCAAGCACAGTCTCAGCCCCATGGGGTATATCCACCCTCAAGTGTGGCACAGGGGCAGAGCCAGGGTCAGCCATCCTCAAGTAGCTTAACAGGGGTTTCATCTTCCCAACCCATACAACATCCTCAGCAGCAGCAGGGAATACAGCAGACAGCCCCTCCTCAACAGACAGTGCAGTATTCACTTTCACAGACATCAACCTCCAGTGAGGCCACTACTGCACAGCCAGTGAGTCAGCCTCAAGCTCCACAAGTCTTGCCTCAAGTATCAGCTGGAAAACAGGGCTTCCCACCTCGACTGCCACCACAGTACCCAGGAGATTCAAATATTGCTCCCTCTTCCAACGTGGCTTCTGTTTGCATCCATTCTACAGTCCTATCCCCTCCCATGCCGACAGAAGTACTGGCTACACCTGGGTACTTTCCCACAGTGGTGCAGCCTTATGTGGAATCAAATCTTTTAGTTCCTATGGGTGGTGTAGGAGGACAGGTTCAAGTGTCCCAGCCAGGAGGGAGTTTAGCACAAGCCCCCACTACATCCTCCCAGCAAGCAGTTTTGGAGAGTACTCAGGGAGTCTCTCAGGTTGCTCCTGCAGAGCCAGTTGCAGTAGCACAGACCCAAGCTACCCAGCCGACCACTTTGGCTTCCTCTGTAGACAGTGCACATTCAGATGTTGCTTCAGGTATGAGTGATGGCAATGAGAACGTCCCATCTTCCAGTGGAAGGCATGAAGGAAGAACTACAAAACGGCATTACCGAAAATCTGTAAGGAGTCGCTCTCGACATGAAAAAACTTCACGCCCAAAATTAAGAATTTTGAATGTTTCAAATAAAGGAGACCGAGTAGTAGAATGTCAATTAGAGACTCATAATAGGAAAATGGTTACATTCAAATTTGACCTAGATGGTGACAACCCCGAGGAGATAGCAACAATTATGGTGAACAATGACTTTATTCTAGCAATAGAGAGAGAGTCGTTTGTGGATCAAGTGCGAGAAATTATTGAAAAAGCTGATGAAATGCTCAGTGAGGATGTCAGTGTGGAACCAGAGGGTGATCAGGGATTGGAGAGTCTACAAGGAAAGGATGACTATGGCTTTTCAGGTTCTCAGAAATTGGAAGGAGAGTTCAAACAACCAATTCCTGCGTCTTCCATGCCACAGCAAATAGGCATTCCTACCAGTTCTTTAACTCAAGTTGTTCATTCTGCGGGAAGGCGGTTTATAGTGAGTCCTGTGCCAGAAAGCCGATTACGAGAATCAAAAGTTTTCCCCAGTGAAATAACAGATACAGTTGCTGCCTCTACAGCTCAGAGCCCTGGAATGAACTTGTCTCACTCTGCATCATCCCTTAGTCTACAACAGGCCTTTTCTGAACTTAGACGTGCCCAAATGACAGAAGGACCCAACACAGCACCTCCAAACTTTAGTCATACAGGACCAACATTTCCAGTAGTACCTCCTTTCTTAAGTAGCATTGCTGGAGTCCCAACCACAGCAGCAGCCACAGCACCAGTCCCTGCAACAAGCAGCCCTCCTAATGACATTTCCACATCAGTAATTCAGTCTGAGGTTACAGTGCCCACTGAAGAGGGGATTGCTGGAGTTGCCACCAGCACAGGTGTGGTAACTTCAGGTGGTCTCCCCATACCACCTGTGTCTGAATCACCAGTACTTTCCAGCGTAGTTTCAAGTATCACAATACCTGCAGTTGTCTCAATATCTACTACATCCCCGTCACTTCAAGTCCCCACATCCACATCTGAGATCGTTGTTTCTAGTACAGCACTGTATCCTTCAGTAACAGTTTCAGCAACTTCAGCCTCTGCAGGGGGCAGTACTGCTACCCCAGGTCCTAAGCCTCCAGCTGTAGTATCTCAGCAGGCAGCAGGCAGCACTACTGTGGGAGCCACATTAACATCAGTTTCTACCACCACTTCATTCCCAAGCACAGCTTCACAGCTGTGCATTCAGCTTAGCAGCAGTACTTCTACTCCTACTTTAGCTGAAACCGTGGTAGTTAGCGCACACTCACTAGATAAGACATCTCATAGCAGTACAACTGGATTGGCTTTCTCCCTCTCTGCACCATCTTCCTCTTCCTCTCCTGGAGCAGGAGTGTCTAGTTATATTTCTCAGCCTGGTGGGCTGCATCCTTTGGTCATTCCATCAGTGATAGCTTCTACTCCTATTCTTCCCCAAGCAGCAGGACCTACTTCTACACCTTTATTACCCCAAGTACCTAGTATCCCACCCTTGGTACAGCCTGTTGCCAATGTGCCTGCTGTACAGCAGACACTAATTCATAGTCAGCCTCAACCAGCTTTGCTTCCCAACCAGCCCCATACTCATTGTCCTGAAGTAGATTCTGATACACAACCCAAAGCTCCTGGAATTGATGACATAAAGACTCTAGAAGAAAAGCTGCGGTCTCTGTTCAGTGAACACAGCTCATCTGGAGCTCAGCATGCCTCTGTCTCACTGGAGACCTCACTAGTCATAGAGAGCACTGTCACACCAGGCATCCCAACTACTGCTGTTGCACCAAGCAAACTCCTGACTTCTACCACAAGTACTTGCTTACCACCAACCAATTTACCACTAGGAACAGTTGCTTTGCCAGTTACACCAGTGGTCACACCTGGGCAAGTTTCTACCCCAGTCAGCACTACTACATCAGGAGTGAAACCTGGAACTGCTCCCTCCAAGCCACCTCTAACTAAGGCTCCGGTGCTGCCAGTGGGTACTGAACTTCCAGCAGGTACTCTACCCAGCGAGCAGCTGCCACCTTTTCCAGGACCTTCTCTAACCCAGTCCCAGCAACCTCTAGAGGATCTTGATGCTCAATTGAGAAGAACACTTAGTCCAGAGATGATCACAGTGACTTCTGCGGTTGGTCCTGTGTCCATGGCGGCTCCAACAGCAATCACAGAAGCAGGAACACAGCCTCAGAAGGGTGTTTCTCAAGTCAAAGAAGGCCCTGTCCTAGCAACTAGTTCAGGAGCTGGTGTTTTTAAGATGGGACGATTTCAGGTTTCTGTTGCAGCAGACGGTGCCCAGAAAGAGGGTAAAAATAAGTCAGAAGATGCAAAGTCTGTTCATTTTGAATCCAGCACCTCAGAGTCCTCAGTGCTATCAAGTAGTAGTCCAGAGAGTACCTTGGTGAAACCAGAGCCGAATGGCATAACCATCCCTGGTATCTCTTCAGATGTGCCAGAGAGTGCCCACAAAACTACTGCCTCAGAGGCAAAGTCAGACACTGGGCAGCCTACCAAGGTTGGACGTTTTCAGGTGACAACTACAGCAAACAAAGTGGGTCGTTTCTCTGTATCAAAAACTGAGGACAAGATCACTGACACAAAGAAAGAAGGACCAGTGGCATCTCCTCCTTTTATGGATTTGGAACAAGCTGTTCTTCCTGCTGTGATACCAAAGAAAGAGAAGCCTGAACTGTCAGAGCCTTCACATCTAAATGGGCCGTCTTCTGACCCGGAGGCCGCTTTTTTAAGTAGGGATGTGGATGATGGTTCCGGTAGTCCACACTCGCCCCATCAGCTGAGCTCAAAGAGCCTTCCTAGCCAGAATCTAAGTCAAAGCCTTAGTAATTCATTTAACTCCTCTTACATGAGTAGCGACAATGAGTCAGATATCGAAGATGAAGACTTAAAGTTAGAGCTGCGACGACTACGAGATAAACATCTCAAAGAGATTCAGGACCTGCAGAGTCGCCAGAAGCATGAAATTGAATCTTTGTATACCAAACTGGGCAAGGTGCCCCCTGCTGTTATTATTCCCCCAGCTGCTCCCCTTTCAGGGAGAAGACGACGACCCACTAAAAGCAAAGGCAGCAAATCTAGTCGAAGCAGTTCCTTGGGGAATAAAAGCCCCCAGCTTTCAGGTAACCTGTCTGGTCAGAGTGCAGCTTCAGTCTTGCACCCCCAGCAGACCCTCCACCCTCCTGGCAACATCCCAGAGTCCGGGCAGAATCAGCTGTTACAGCCCCTTAAGCCATCTCCCTCCAGTGACAACCTCTATTCAGCCTTCACCAGTGATGGTGCCATTTCAGTACCAAGCCTTTCTGCTCCAGGTCAAGGAACCAGCAGCACAAACACTGTTGGGGCAACAGTGAACAGCCAAGCCGCCCAAGCTCAGCCTCCTGCCATGACGTCCAGCAGGAAGGGCACATTCACAGATGACTTGCACAAGTTGGTAGACAATTGGGCCCGAGATGCCATGAATCTCTCAGGCAGGAGAGGAAGCAAAGGGCACATGAATTACGAGGGCCCTGGAATGGCAAGGAAGTTCTCTGCACCTGGGCAACTGTGCATCTCCATGACCTCGAACCTGGGTGGCTCTGCCCCCATCTCTGCAGCATCAGCTACCTCTCTAGGTCACTTCACCAAGTCTATGTGCCCCCCACAGCAGTATGGCTTTCCAGCTACCCCATTTGGCGCTCAATGGAGTGGGACGGGTGGCCCAGCACCACAGCCACTTGGCCAGTTCCAACCTGTGGGAACTGCCTCCTTGCAGAATTTCAACATCAGCAATTTGCAGAAATCCATCAGCAACCCCCCAGGCTCCAACCTGCGGACCACTTAGACCTAGAGACATTAACTGAATAGATCTGGGGGCAGGAGATGGAATGCTGAGGGGGTGGGT