Transcript asmbl_63057

Sequence
Transcript Sequence for observation asmbl_63057 of TGE0006885:
CGGAAGTAGCGTGTGGGTCTCTTCCCTTCTGTGGCCATCGCTGAAACTCCAGCGGCCAGTATGAAGTTCAACCCCTTTGTGACTTCTGACCGGAGCAAGAACCGTAAAAGGCATTTCAATGCACCTTCCCACATTCGCAGGAAGATTATGTCTTCTCCTCTTTCCAAAGAGCTGAGACAGAAGTACAATGTTCGATCCATGCCTATAAGAAAAGATGATGAGGTTCAGGTTGTGCGAGGACACTACAAAGGGCAGCAAATTGGCAAAGTAGTCCAGGTTTACAGGAAGAAATACGTCATCTACATTGAACGAGTGCAGCGGGAGAAGGCTAATGGCACAACTGTTCATGTCGGCATTCACCCCAGCAAGGTGGTTATCACTAGACTAAAGCTGGACAAAGACCGCAAAAAGATCCTTGAACGTAAAGCCAAATCTCGCCAAGTAGGAAAGGAAAAGGGCAAATATAAGGAAGAAACAATTGAGAAGATGCAGGAATAAAGTAATCATACACAGTTTTCATTAAAAACTTGTAAATG