Transcript asmbl_13854

Sequence
Transcript Sequence for observation asmbl_13854 of TGE0000213:
AGCGGCGGCGGCAGCGCCAAGGAGCCACAGGAGGAACGGAGCCAGCAGCAGGATGATATCGAAGAGCTGGAGACCAAGGCCGTGGGAATGTCTAACGATGGCCGCTTTCTCAAGTTTGACATCGAAATCGGCAGAGGCTCCTTTAAGACGGTCTACAAAGGTCTGGACACTGAAACCACCGTGGAAGTCGCCTGGTGTGAACTGCAGGATCGAAAATTAACAAAGTCTGAGAGGCAGAGATTTAAAGAAGAAGCTGAAATGTTAAAAGGTCTTCAGCATCCCAATATTGTTAGATTTTATGATTCCTGGGAATCCACAGTAAAAGGAAAGAAGTGCATTGTTTTGGTGACTGAACTTATGACGTCTGGAACACTTAAAACGTATCTGAAAAGGTTTAAAGTGATGAAGATCAAAGTTCTAAGAAGCTGGTGCCGTCAGATCCTTAAAGGTCTTCAGTTTCTTCATACTCGAACTCCACCTATCATTCACCGCGATCTTAAATGTGACAACATCTTTATCACCGGCCCTACTGGCTCAGTCAAGATTGGAGACCTCGGTCTGGCAACCCTGAAGCGGGCTTCTTTTGCCAAGAGTGTGATAGGTACCCCAGAGTTCATGGCCCCTGAGATGTATGAGGAGAAATATGATGAATCCGTTGACGTTTATGCTTTTGGGATGTGCATGCTTGAGATGGCTACATCTGAATATCCTTACTCGGAGTGCCAAAATGCTGCACAGATCTACCGTCGCGTGACCAGTGGGGTGAAGCCAGCCAGTTTTGACAAAGTAGCAATTCCTGAAGTGAAGGAAATTATTGAAGGATGCATACGACAAAACAAAGATGAAAGATATTCCATCAAAGACCTTTTGAACCATGCCTTCTTCCAAGAGGAAACAGGAGTACGGGTAGAATTAGCAGAAGAAGATGATGGAGAAAAAATAGCCATAAAATTATGGCTACGTATTGAAGATATTAAGAAATTAAAGGGAAAATACAAAGATAATGAAGCTATTGAGTTTTCTTTTGATTTAGAGAGAGATGTCCCAGAAGATGTTGCACAAGAAATGGTAGAGTCTGGGTATGTCTGTGAAGGTGATCACAAGACCATGGCTAAAGCTATCAAAGACAGAGTATCATTAATTAAGAGGAAACGAGAGCAGCGGCAGTTGGTACGGGAGGAGCAAGAAAAAAAAAAGCAGGAAGAGAGCAGTCTCAAACAGCAGGTAGAACAATCCAGTGCTTCCCAGACAGGAATCAAGCAGCTCCCTTCTGCTAGCACCGGCATACCTACTGCTTCTACCACTTCAGCTTCAGTTTCTACACAAGTAGAACCTGAAGAACCTGAGGCAGATCAACATCAACAACTACAGTACCAGCAACCCAGTATATCTGTGTTATCTGATGGGACGGTTGACAGTGGTCAGGGATCCTCTGTCTTCACAGAATCTCGAGTGAGCAGCCAACAGACAGTTTCATATGGTTCCCAACATGAACAGGCACATTCTACAGGCACAGTCCCAGGGCATATACCTTCTACTGTCCAAGCACAGTCTCAGCCCCATGGGGTATATCCACCCTCAAGTGTGGCACAGGGGCAGAGCCAGGGTCAGCCATCCTCAAGTAGCTTAACAGGGGTTTCATCTTCCCAACCCATACAACATCCTCAGCAGCAGCAGGGAATACAGCAGACAGCCCCTCCTCAACAGACAGTGCAGTATTCACTTTCACAGACATCAACCTCCAGTGAGGCCACTACTGCACAGCCAGTGAGTCAGCCTCAAGCTCCACAAGTCTTGCCTCAAGTATCAGCTGGAAAACAGCTTCCAGTTTCCCAGCCAGTACCAACTATCCAAGGCGAACCTCAGATCCCAGTTGCGACACAACCCTCGGTTGTTCCAGTCCACTCTGGTGCTCATTTCCTTCCAGTGGGACAGCCGCTCCCTACTCCCTTGCTCCCTCAGTACCCTGTCTCTCAGATTCCCATATCAACTCCTCATGTGTCTACGGCTCAGACAGGTTTCTCATCCCTTCCCATCACAATGGCAGCTGGCATTACTCAGCCTCTGCTCACGTTGGCTTCATCTGCTACAACAGCTGCGATCC