Transcript asmbl_62004

Sequence
Transcript Sequence for observation asmbl_62004 of TGE0006790:
AAACAACACATATCCATCTAAATTTTTTTATAGCCTTCCATGTTAAACTATAAATAAGTAATTAGTTTTAAAATTGTTTTGTATTTTCTTATTCCTGTTCCCTTTACCCTTTGACAACTTGAAATGTTACCACTTCGTCCTCATGATGTTCTTCTATCAACCCTGCTTAGGATGAGAACAAGTTGAGCAGTGCTAATGGCCATGAAGAACGTAGCAAAAAGAGGAAAAAAAGCAAGAGCAGAAGTCGTAGTCATGAACGAAAAAGAAGCAAAAGTAAGGAACGGAAGCGAAGCAGGGATAGAGAAAGGAAAAAGAGCAAAAGTCGTGAAAGGAAGCGAAGTAGAAGCAAAGAAAGGAGACGGAGCCGCTCAAGAAGTCGAGATCGCAGATTCAGAGGCCGCTACAGAAGTCCTTACTCCGGACCAAAATTTAACAGTGCCATCCGAGGAAAGATTGGGTTGCCTCATAGCATCAAATTAAGCAGACGACGCTCCCGAAGCAAAAGTCCATTCAGAAAAGACAAGAGTCCTGTGAGGGAACCAATTGATAATCTAACTCCTGAGGAAAGAGATGCAAGGACAGTTTTCTGCATGCAGCTGGCAGCAAGAATTCGGCCAAGGGATTTGGAAGAGTTTTTCTCTACAGTTGGGAAGGTTCGAGATGTAAGGATGATATCTGATAGAAATTCAAGACGTTCCAAGGGCATTGCTTATGTGGAGTTTGTCGATGTTAGCTCAGTGCCTCTAGCAATAGGATTAACTGGCCAACGTGTTTTAGGAGTGCCAATCATAGTACAGGCGTCACAGGCGGAAAAAAACAGAGCTGCAGCAATGGCAAACAATCTACAAAAGGGAAGTGCTGGACCTATGAGGCTTTATGTGGGCTCCTTACACTTTAACATAACTGAGGATATGCTTCGGGGGATCTTTGAACCTTTTGGCAGGATTGAAAGTATCCAGCTCATGATGGATAGTGAAACAGGTCGATCTAAGGGATATGGATTTATTACGTTTTCCGATTCAGAATGTGCCAAGAAGGCTTTGGAACAACTTAATGGATTTGAGCTGGCAGGAAGGCCGATGAAAGTTGGACATGTTACTGAACGTACTGATGCTTCCAGTGCTAGCTCATTTTTGGACAGTGATGAATTGGAAAGGACTGGAATTGACCTGGGAACAACTGGTCGTCTCCAATTAATGGCAAGACTGGCAGAGGGTACAGGTTTGCAGATCCCACCAGCAGCACAGCAAGCTCTACAGATGAGTGGCTCTTTGGCATTTGGTGCTGTGGCAGATTTGCAAACAAGACTTTCTCAACAGACTGAAGCTTCAGCTTTAGCTGCAGCTGCCTCTGTTCAACCTCTTGCAACACAGTGTTTTCAACTCTCTAACATGTTTAACCCTCAAACAGAAGAAGAAGTTGGATGGGATACAGAGATTAAAGATGATGTGATTGAAGAATGTAATAAACACGGAGGAGTTATTCATATTTATGTTGACAAAAATTCAGCTCAGGGCAACGTGTATGTGAAGTGCCCATCAATTGCTGCAGCCATTGCTGCTGTCAATGCATTACATGGCAGGTGGTTTGCTGGTAAAATGATAACAGCAGCATATGTACCTCTTCCAACTTATCACAACCTCTTTCCTGATTCTATGACAGCAACACAACTACTGGTTCCAAGTAGACGATGAAGGAAGATATAGTCCCTTATGTACATAGCTTTTTTTCTTTCTTGAGAATTCATCTTGAGTTATCTTTTATTTAGATAAAAATAAAGAGGCAAGGGTCTACTGTCATTTGTATACAATTCCTGTTATCTTGAAAAAATAAAAATGTTAACAGGAATGCAGTGTGCTCATTCTCCCTAACTAGCAATTCCCACTGTATACAAAGCTGTTCTCTAGTTCTGCCTTTTAAATGTACATGTAGAAAATTACATTAAGGATCTATAGAAATAGCTCTAGGGGAACAAATGTGCTTAATGTAAAAAGGCAGACAGGGATGTAATGATGTTTTTAATGTTTCAGAAGCCTAACTTTTTACACAGCAGTTACATTTCTCATTCACTAATGTTGATATTTGGCTAATGGTTTAGCAGAGGTTTCTGGAATACACTTTTAGTGAATGGAAATTGAAGACAGCTAAAGGGCTGTTGATTAACATCTCATCTTGCATTCTGGTCAATTGGCAAGAAAAGGAGATTTCAAAATTAACATTTCTGGATGGTATCTTTTCAATTAATGTATCTGTAAAAGTTTCTTTGTAAATATGTGTTCTAGTGTGTCTAAGATTCCAAACAAAATGATCCCTGCATTTCCTCAAGATGTTTAGTGACAGTCTGGTAAGGAAAGAAATAGGAAATGCAGAAATAGGTTTTGTCTGGTTGCATATCTTTGCTCTTTTTAAGCTCTGTGAGCTCTGAAATATATTTTTGGGTTACTTCAGTGTGTTTGACAAGACAGCTTGATATTTCTATCAAACAAATGACTTTCATATTGCAACAATCTTTGTAAGAACCACTCAAATAAAATTCTCTTAAAAAGGCCATAAGAAAATCTTCATTTTTGAAATGTTTTAAAGTCATAGAAACTTGAAAATAGAATACTAGTTTCTTTGACTCGGTATTTGCCTCTTTGGGAAAATTCTTAGC