Transcript asmbl_61910

Sequence
Transcript Sequence for observation asmbl_61910 of TGE0006772:
CTTAGCTTCTACTATGATGGTAACATTTTTCGTCAACAGCAGTTCACCTAGTGAGTGATGATACTTTGGGTCTGAGTGAAGCTGAGGATAGAGGAAAATACTGGGGATGGGGAGTAGTTTGTCCCTTTAGGAGCTGACAGGCTTTGTTCACCCCTACACATACATACATTCAGAGGTGCCCACAAGTGTATTTGGGGAGAAGCTTCGAGAACAAGTGGAGGAGCGGCTATCCTTCTATGAGACCGGAATTTTTCCACGGAAGAACCTGCAGGTTATGAAGGAAGCCATGGTTCAGGCAGAGGAGGCGGCTGCTGAGATTACTAGGAAGCTGGAGAAACAGGAGAAGAAACGCTTGAAGAAAGAAAAAAAACGGTTGGCCGCCATTGCTCTTGCATCTCCAGAAAACAGCACTAGTACGCCAGAGGAGTGTGAGGAGATAAGTGAAAGACCCAAAAAGAAGAAAAAGCAAAAGCTCCAAGAGGCTCCTCAGGAGAATGGAATGGAAGAGCCACCTGTCTCTTTAGCCAAACCCAAGAAAAAGAAAGCTTTTTCCAAGGAGGAGCTGATCAGTAGTGATTTAGAAGAAACAGCTGGCAGTGGAAGTCTTCCCAAGAGGAAGAAATCTTTCCCCAAAGAAGAACCAGTTAGTGACCCTGAAGAGGCAGAAAACAGGAGTGTCCCTAAAAAAAAGAGGAAATTTAAGGAGGAGCTGCTCAGCAGTGGACCTGAAGAAGCTGCTAGCAGCAAGAGCAGTAGCTCCAAGAAAAAGAAAAAGCTGCAGAAGCTATCCCAGGGAGATTAGAATGGACAGTGCCCTGGTGGGACATAACCACCCACAGTGACATTTCCCAACCCATCCCTTATATCCCAATAAAAACATTCACAAGCTGA