Transcript asmbl_60522

Sequence
Transcript Sequence for observation asmbl_60522 of TGE0006711:
CGGGAGCCGAGGCTTGCAGCGGGACTCCCCGCTGAGAGCGCGACGCGGCCTTGAGCGGCAGACGGCGCAGTAGGCCGAGGGGGAGGCGCGGCAGCCGCCCTGGCCCGTCATGGAGATGGAAAAGGAGTTCGAGCAGATCGACAAAGCCGGGAGCTGGGCGGCCATTTACCAGGATATCCGACACGAAGCCAGTGACTTCCCGTGTAGAGTGGCCAAGCTTCCCAAGAACAAAAACCGAAACAGGTACAGAGATGTCAGTCCCTTTGACCATAGTCGGATTAAACTTCATCAAGAAGATAACGACTATATCAACGCTAGTTTGATAAAAATGGAAGAAGCCCAAAGAAGTTACATTCTTACCCAGGGCCCTTTGCCTAATACGTGCGGCCACTTCTGGGAGATGGTATGGGAGCAGAAGAGCAGGGGCGTGGTCATGCTCAACCGAGTGATGGAGAAAGGATCGTTAAAATGTGCGCAGTACTGGCCACAAAAAGAAGAAAAAGAAATGGTCTTTGAAGACACAAATTTGAAATTAACATTGGTCTCCGAAGATATTAAGTCATATTATACAGTACGACAACTAGAATTGGAAAACCTTTCATCTAAAGAAACTCGAGAGATCTTACATTTCCACTATACCACGTGGCCTGACTTTGGAGTCCCCGAATCTCCAGCCTCTTTCCTGAACTTTCTTTTCAAAGTCCGCGAGTCGGGGTCACTCAGCCGGGAGCATGGCCCCATCGTGGTACACTGCAGCGCTGGCATCGGCAGGTCGGGGACCTTCTGTCTGGCCGACACCTGTCTCTTGCTGATGGACAAGAGGAAAGACCCTTCTTCTGTCGATATCAAGAAAGTCCTGTTAGAAATGAGGAAATTTCGAATGGGACTGATCCAGACAGCAGACCAGCTCCGTTTCTCCTACCTAGCTGTGATCGAAGGTGCCAAATTCATCATGGGAGACTCTTCAGTGCAGGAGCAATGGAAGGAGCTCTCCCACGAGGACCTGGAGCCCCCACCTGAGCATGTCCCCCCACCTCCCCGGCCACCCAAACGAATCCTGGAGCCACACAATGGGAAATGCAAGGAATTCTTTCCAAACCACCAGTGGGTAAAGGATGAGTCTGAGGAAGATAAAGAAGATGGCCCCATCAAGGAAGAAACCATAACACCCTTAAGTGTCCCCTGCATGGAACGCACGAGTCAAGACACTGAAGTCAGAAGGCGGGTCGTGGGGGCAGGTCCTGCTCAGGGGGAGCCGTCGCCACCCAAGGAGGAGCAGGACCAGGCTCTGACTCACTGGAAGCCCTTCCTGGTCAACATGTGCATGGCCACGGTCCTCACAGCTGGCGCGTACCTCTGCTACAGGGTATGTTTTCACTGACGGACGTGCCGGCAAGACCACGTGTACAGAAAGCACTGGCCGACAGCCTGGCGGTAGCATTCAGTGCTGTGCAAGGATCTGAGCCAGTCTCAGAAGAAACAGATCAAAGTTTTTTAAAGTCTGGAACTGTGAAGGGCTAACAAGAGAGAATTGAGGATTGATGCACTGGGGTTTTAAGGAGCCCTGTGGTCCCAAGAATACAACAGTCTAATCTCAGGGCCTTAACCTATTCAGGAGTAAGTAGAGAAAATGCCAAATACATCTCTCTCTCTTCATTTTTCTTTCTTTCTTTTTCTT