Transcript asmbl_60096

Sequence
Transcript Sequence for observation asmbl_60096 of TGE0006642:
GCCTGGGGCTGGGATGTGACGGACTGCTGGTCCCGTCAGTGGCGTCTTCCCTGAGCGGCGGTGACTGCGGCGAGGGCGGCGTGGACAAGGCCAGCGGGCGCCATTGGCGACCGGCCGTGTCGGCCGCGGGATGAGGAAGCGGACCGAGCCCGTCGCCTTGGAGCATGAGCCCTGCGCCGTCTCGGGCTCGACTTCCTCCGGCTCGGCCGCCGCGGTGCTGGACACCGACTGCAGCCTGAAGCGGAAACTGTGCCTGGCGGGCAGGGGACCGGGCGAGACGCGCAGCGCCGCGGACGCGGACATGAAGCGGGCGCTAGGCAGGCGAAAGGGCCTGTGGTTCCGACTGAGGAAGATACTTCTCTATGTTTTGGGGTTATACATTGCCATTCCATTTCTCATCAAACTATGTCCTGGGATACAGGCCAAACTGATTTTCTTGAATTTTGTGAGGGTTCCCTATTTCATTGACTTGAAAAAACCACAGGATCAAGGTTTGAATCACACCTGCAATTACTACCTCCAGCCAGAGGAAGATATAACCATTGGAGTCTGGCACACTGTCCCCACTGTCTGGTGGAAGACTGCCCAAGGGAAGGACCAGATGTGGTACGAGGATGCCTTGGCTTCCAGTTACCCTATCATCCTGTACCTGCATGGGAATGCAGGTACCAGAGGAGGTGACCACCGAGTGGAACTTTACAAGGTGCTGAGTTCCCTTGGTTACCACGTGGTCACTTTTGACTATAGAGGTTGGGGTGACTCAATAGGCACGCCATCAGAGCGGGGCATGACCTATGATGCACTCCATGTTTTTGACTGGATTAAAGCGAGAAGTGGAGACAACCCCGTGTATATTTGGGGCCACTCCCTAGGCACTGGAGTGGCAACAAATCTGGTGCGGCGCCTCTGTGAGCGAGAGACACCTCCAGATGCCCTAATATTGGAATCTCCATTCACCAATATTCGTGAAGAAGCTAAGAGCCATCCGTTCTCAGTGATATATCGATATTTCCCTGGATTTGACTGGTTCTTCCTTGATCCCATTACAAGCAGTGGAATTAAATTTGCAAATGATGAAAATGTGAAGCACATCTCCTGCTCCCTGCTCATCTTGCACGCTGAGGATGACCCAGTTGTGCCCTTCCAGCTTGGCAGAAAGCTCTACAACATTGCTGCACCCTCTCAGAGCTTCCGAGACTTCAAAGTTCAGTTTATCCCCTTTCACTCAGACCTCGGCTACAGGCACAAGTACATCTACAAGAGCCCTGAGCTTCCTCGAATACTAAGGGAATTCCTGGGGAATTCGGAACCTGAGCACCAGCACTGAGCTCACTGCTTGAAGGAGCATGAAGACCTTTGCCCTCCTCCCCATTCCTCCAGCCAACCCAGCACCGTGGAGCAAGGGTACCAGCGTCTGTGATGCACCTGGAGAGAGGACTCGGATGCCATCTAGGGCAGGAAGAGGAGGCCACAGCAGACTGGTGGCCAGGAGCATAGATCTTTGTGGAAAATGCGAGTGGCAGGCATGTGGCCCTCTCTCCCTCTTGCTGCCACTCAACCTGAGTTCTTGGAAGGACAGTGACACAGCAGGCAGCAACCAGCAGGTCGATCCCACACTTCTTGAGCTGGGTATGGAGAATGAGGCAGGAAGTATGAAGTCTTGGGACCACACTGAGCTATCCGGTACCACCCATGAGAATGTGAGGACACTTGGGTTCTTCTGTCCCTTCCCAGCACATGCAGAATGGACTCTGTTGGTTCCATAGCCCCTTCCTGCCCTCTGCACCCCCACTTGCCTTCCTTGGTGTCCCTGCCTCCCTTGGCAGGCCCACCACTCACAGAGAGGGAAGTGCCCACGATCTGCACTTCCTCCACTTTCCACCCACCTGTTCACCTGAGCGTTTATTTAATAAAATCCTAGTGGTGGTC