Transcript asmbl_58965

Sequence
Transcript Sequence for observation asmbl_58965 of TGE0006627:
GGAAACGCCTCCGTCTCTATATAAGGAATTTCCCGGACTCTTGCGGCCTCTTTTTTTCCTCTTAACGTTCAGCGAGAACTGCAAACGATCCTGTTTCCTCCGCTGCTGCCCAGTTGCCGGACCAGCAAACGCCATGGGTTTTGGAGACCTGAAAAGCCCCGCTGGCCTCCAGGTGCTCAACGACTACCTGGCGGACAAGAGCTACATCGAGGGGTATGTACCATCACAAGCAGATGTAGCAGTATTTGAAGCAGTCTCTGGCCCACCACCTGCCGACTTGTACCATGCCCTACGTTGGTATAATCACATCAAGTCTTACGAAAAGGAAAAGGCCAGCCTGCCTGGAGTGAAGAAAGCTTTGGGCAAATATGGCCCTGCTAATGTGGAAGACACCACTGGAAGTGGAGCTACAGATAGTAAAGATGATGATGACATTGATCTCTTTGGATCTGATGATGAAGAGGTATGGCATAAATTGATGTAAGTATCAGACTCTTGGATTTGAATCCTGGCTTCATTTATCACCTTTCTTTTAAAAATTCTTACTGGTTACATGATGAATAAAATCAAATCACCATCTTTCGGCTGAGCTCATGATGATTTGCTTTTTTCTGATAAAGCTGGTCTGTTGTGATGACCCACTGTCTTTAAGCTGAGGAACAACCAGTTTTGTGAAGTGTGTTAAATTTTTTCTTTATAGGAGAGCGAAGAAGCAAAGAGGCTAAGAGAAGAGCGCCTTGCACAGTATGAGTCAAAGAAAGCCAAAAAGCCTGCACTTGTTGCCAAGTCTTCCATCTTATTAGATGTGAAACCTTGGGATGATGAGACAGATATGGCTAAATTGGAGGAGTGCGTCAGGAGCATTCAAGCAGATGGCTTGGTCTGGGGCTCTTCTAAACTAGTTCCAGTGGGGTATGGAATTAAAAAACTTCAGATACAGTGTGTAGTAGAAGACGATAAAGTTGGAACAGATATGCTGGAGGAGCAGATCACTGCTTTTGAGGACTATGTGCAGTCCATGGACGTGGCTGCTTTCAACAAGATCTGAAATCCATCATGGATCATTACTCTTAAATAAAAGCTTGAAAGACA