Transcript asmbl_58867

Sequence
Transcript Sequence for observation asmbl_58867 of TGE0013670:
GTTTATGTAAATATTAAATTACTTTAGTAGAAGTATTTCCTAGACTTAAAAGTACTAATGTGCAGTATATTAATTATAATGATAGCAGTTTGAAATTTTGATATTCACTTAAAACTTAACTGCAGTGGTGCCTACATTAACATTTATGTCTCATTTTTTTGCAGCAAGGAGTGAATAATGCTGAAAAATTTGACTATGTGATGCAGTTTTTGAATAAGATGGCTGGTAATGAATATGTTGGATTCAGTAATGCAACGTTTCAGTCTGAAAGAGAAAGTGGAGATCGAAATTTTGCAATAGGATATTACTTAAAAGAAAAAAAGTGTTTTCCAGAAGGTACAGATATGGTTGGTATATTAGACTTCTATTTCCAGCTGTGCTCCATTGAAGTAACTTGTGAATCAGCTAGTGTGATGGCTGCAACACTGGCTAATGGCGGTTTCTGTCCAATTACTGGTGAAAGAGTGCTGAGCCCTGAAGCAGTTCGAAATACACTGAGTTTGATGCATTCCTGTGGCATGTATGATTTCTCGGGGCAGTTTGCTTTCCACGTTGGTCTTCCTGCAAAATCTGGAGTTGCTGGGGGCATTCTTTTAGTTGTACCCAATGTCATGGGCATGATGTGCTGGTCTCCCCCTCTGGACAAGATGGGCAACAGTGTTAAGGGAATTCACTTCTGTCATGATCTTGTTTCTCTGTGTAATTTCCATAACTATGATAATTTGAGACACTTTGCAAAAAAACTTGATCCTCGTAGAGAAGGTGGTGATCAAAGGCATTCCTTTGGACCATTGGACTATGAAAGTCTCCAACAAGAACTTGCTTTAAAAGAGACAGTATGGAAAAAAGTGTCACCTGAGTCAAATGAGGACATCTCTACAACTGTAGTATATAGAATGGAAAGTCTGGGAGAGAAAAGCTAAAAGAAATGAGTTCTAGTTTCAGAACATTCTTCATTTAACCTTTCGAACACCTTTAGCTTTTTTGCATACTATATATATTTATTTGAGTGTTTGTGTTCTTAACCTTGGGTGCTTGAGCCATAAAGCTATTTTTTTTCTTTTAATCTTTGTGTAAAGATAATAGATTAAAAAGTGGAATTGCCAGGTTTTTTTTTAAGTAAATAAAGCACATTTGCTTTATTTAAAAAAATGCAAAAAGGAAA