Transcript asmbl_44064

Sequence
Transcript Sequence for observation asmbl_44064 of TGE0002156:
GGCGCGAAGGCTCAGGCGCCTCCTCCCGCCACAGTCACTGTGGCTCGGCGCACGCTGCCGGCGGCTGCCCTTTCCGCCTCTGGGGAAGAAAAACCCGCGGGCCGCTTTCGTGCTTGAACCATGGCCTCGGGCCGGAGGGGCTGGGACAGCTCCCACGAAGACGATCTGCCCGTGTACCTGGCCAGGCCGGGCACCACGGACCAGGTCCCGCGGCAGAAATACGGCGGCATGTTCTGCAACGTGGAGGGCGCCTTCGAGAGCAAGACGCTGGATTTCGATGCCCTCAGCGTGGGGCAGCGGGGCGCGAAGACTCCTCGGAGCGGCCAGGGCAGCGACCGAGGATCGGGGAGTCGGCCCGGGATCGAGGGGGACACCCCGCGCAGGGGCCAAGGCCGGGAAGAGAGCAGGGAGCCCGCGCCCGCCTCCCCCGCCCCCGCCGGGGTAGAGATCCGGAGCGCCACCGGCAAAGAGGTGTTGCAGAACCTCGGCCCCAAGGACAAGAGTGACCGTCTCCTTATCAAGGGAGGCAGAATCGTCAATGATGATCAGTCCTTTTATGCTGATATTTACATGGAAGATGGCTTAATAAAACAAATTGGAGACAATCTGATTGTTCCTGGAGGAGTGAAGACCATTGAAGCCAATGGGAAGATGGTGATCCCTGGAGGCATCGATGTCCATACTCACTTCCAGATGCCATATAAGGGAATGACCACAGTAGATGACTTCTTCCAAGGGACAAAGGCGGCCTTAGCAGGTGGCACCACCATGATCATTGACCATGTGGTGCCTGAGCCTGAGTCCAGCCTGACTGAGGCCTATGAGAAATGGAGAGAGTGGGCTGATGGGAAGAGTTGCTGTGACTATGCCCTGCATGTGGACATCACCCACTGGAATGACAGCGTCAAGCAGGAAGTGCAGAACCTCATCAAGGACAAAGGGGTTAACTCCTTCATGGTTTATATGGCTTATAAGGATTTGTATCAAGTATCTAACACAGAGCTCTATGAGATCTTCACCTGCCTGGGAGAGCTGGGGGCCATTGCTCAAGTTCATGCTGAGAATGGGGATATCATTGCCCAGGAGCAAACCCGCATGTTGGAAATGGGGATAACTGGCCCAGAAGGCCATGTACTGAGCAGGCCAGAAGAGCTGGAAGCTGAGGCTGTGTTCCGTGCCATCACCATTGCCAGCCAAACCAATTGCCCTCTCTACGTCACAAAGGTCATGAGCAAGAGTGCAGCTGACCTCATCTCACAAGCCAGGAAAAAAGGAAATGTAGTCTTTGGTGAGCCCATCACTGCCAGCCTCGGCATAGATGGAACCCATTATTGGAGCAAGAACTGGGCCAAGGCGGCTGCATTTGTGACATCCCCACCCCTGAGCCCTGACCCAACTACTCCGGACTACATCAACTCCTTGCTGGCCAGCGGGGATCTGCAGCTATCTGGGAGTGCCCACTGCACCTTCAGCACTGCCCAGAAAGCAATTGGGAAGGACAACTTCACAGCCATTCCTGAGGGCACCAATGGTGTGGAGGAGCGGATGTCTGTCATCTGGGACAAGGCTGTGGCCACAGGGAAAATGGACGAAAACCAGTTCGTGGCTGTGACAAGCACAAACGCTGCCAAGATCTTCAACCTGTATCCCCGCAAGGGAAGAATATCTGTGGGTTCTGACAGCGACCTCGTCATCTGGGATCCAGATGCTGTGAAGATCGTCTCTGCCAAGAACCACCAGTCTGCGGCAGAGTACAACATCTTTGAAGGGATGGAGCTGCGCGGGGCTCCTCTGGTTGTCATCTGCCAGGGCAAGATCATGCTGGAAGATGGCAACCTGCACGTGACCCAGGGGGCTGGCCGCTTCATACCCTGCAGCCCGTTCTCCGACTATGTCTACAAGCGCATTAAAGCACGGAGGAAGATGGCAGACCTGCATGCCGTCCCAAGGGGCATGTACGATGGGCCTGTGTTTGACCTGACCACCACCCCCAAAGGTGGCACCCCCGCAGGCTCTGCTCGGGGCTCTCCTACTCGGCCGAACCCACCTGTGAGGAATCTTCATCAGTCGGGATTTAGCCTGTCAGGCACCCAAGTGGATGAGGGGGTTCGCTCAGCCAGCAAGCGCATCGTGGCGCCCCCAGGCGGCCGTTCTAATATCACATCTCTGAGTTAAGCAAGCCTTCCTCAAAGAGAGGGGCAGAAGCAAGAAGAGATTGTTTTGAAGCCAAAATGGTACACCGATATTTAAGAAGGAAAGCGAATCCAAACGGTTGTGATCTAAAGAATCAATAAGCCTCAAGCCTTATGTTTCTCCAATGTTACGCTCGCTTGCCTAGCTTTACGAATATTGCTTTGTTTTCTGTTTATGCATAGCCTTGATTTGTTTGACTCCCCTCCCCCCATTTACATGCATGCAATCAGACAGGCCACTAAGGTAAAAGAGTCTGCTCTATCATAGTGTTGAGAGCGTGTGTAGTGCTGCATCTTATGACAAGGGGACAGACAAGCTGGGACGTCAGGGAAATGAACAAAAGGGACGCAGGTTATTTGGGGTGAGTGGGTGGTGGGAGCCTGGAGCAAGGTGGAGGGTGCAGAGGGGCTGGGGTAGGGCATGTAGGAGGGAGGTGGGTGGGTCAGGTGAGTGGAAGGGGTGTTGTATATTGTGTTGATGACGTACGTTATTTCCATGGAAGATAGCCGCTGTGGCAGCTGTCACATCACCACAGCTCCCTAGGGTCTGCCGAGAAGGCAGGCAGTCTTTGGGTTCTGTTCTTTGTCACGTCCCCTACAAGTAAATTTTGTTTCTTTGAACGTTTATTAAAATGCCAAGACCCAACCATTTCTTCCACCTGCTTGATTGTGCCAGTGTTTGCTCAGGCCTCTTTCTTAGTGTTGCTTTCAAATCCTTCTCTTTCCTGGGTTGGGAAGGCCAGGCAGGGACAGAGCAAATGACACTTCTCTTCCTCTTGCCCTCCCTGCCTCTTTGGTGCTCTTAAAAGCCAGCAGCTGAGAACATAGCACAGGCCCACGTGGTGAGGGCACCCACAGCTTAAAGACGCTTCCTTCTAAACACGGCGAGGTCACCTCTCACTCTTCTGTCTTTGCAAACCGAGAAGAGTGGCATGCTTCTGGCATCCCAAGTCAGGATTTTAGCTCAGATGAGGCAGAATGAAGGGCCTCTCTTACAGGCAGTTTGTGTTTGATTCTCTCGATCCTGGCACATCCATGATAAATAGGAGTTTTTGAAAGTTGGTTTTATTAGGTGTTCCCTAATTTTTACCGTAATAGGTCATCTCAGCTTATATGAAAGTCAAGTGGGGAACTGGGAAAGCCAAAGTCAGTCTTGAGCAGAGGGAGCACATTTTGTGGACCTGGTTCCACCTTTCCATTCCAAACCACCTGTTTCCCCTTCCATTAGCAGAAACTCTGGGGGAACTTTGTGTCTCAGTCCTAGAATCTCCCCAAGTGAGTGGAAGTGACATGATGCAGTCTTCCTCATGGGGCACCTGAAAGAAATTAGTGTGGGTGCTTCGATCTACCTTGTCTGTCAGAGTTGAATATCTCTTTCCCTATCATGCTGCTTCTGAAAATTCAGTTTTGGAGCAAGTCCTGTGAGCAAGATAAGAATCTATAGAACCAAGATGCTCATTTTCAGAAGAAATATGTTCAACCTGGGATCAGACTTCCATGCTCTGGGGAATCCAAGTGGTAGCACCTGTAACCCTGTGTACTAAGTGCTTTGAAGAGAAGAGCAGGCCTCAGACACCTTTTAATTGCTTAGGAGAAACCATTGTCTCTGACTGCAGGTTTGAATAAGTTGAAGACCAGAGAAAAGTACACACTGGGCTACAAAGGAATTTGGAGATAGCCAAGGAACAGGATTTCCCCTAGCAAGCTACCTTCTGTTCAAATCATGAAAAAAGACTATTTCCCCTTAGAATAGGGAAGCTTGCTATTTTAAAGCTCTTGTAGTGCTTTTCTTTTAAGGGAGATGTAGTAAAAGGGAAAATGTAGCTCTTAGTTTACACTTCAAAGATGTGGGGGTCTTTCAGAGAACTAAGAATAACAGTTTTATGTGCAGAGAGAGTTTGCCAGATCTGAAGCATATACCTCATTGACTAGGCTGTTACTTTGGGATAGGTTGCAGTACCAGCCACAGCCAGCAGATAGAGGAAAAGACACACATAAACTCGCTTCTGAGCGTCCACTTCTGCACTCTCTGCTCTGCTGTTACTCAGCCCCTGAGTCTGACTCATCTCTGCACAACCTCTCTGTGCCATGAAGATAAGTCTTCCATGGCCAAATCGGTCATCCGCACTGCCCTTGGGACTTCCGAAGTGAACCATTCCACCAGAACCTTTGATTCTGCACAAGATTTCCTTGCTCTGGGAACAACCCCCAAATGCCCTTGGGAGGAACAACATGAGCTCAGGAAGCCTCTCTTTCTTCACTTACCATTACTAACTCTCCAAGCATAGAAATCCCTGGGAATTGCGAGAATAACTCCCACTATTTTAAAATTTATATTCAGATTTGTTTCGTTTCATAAGACACATCAAACAGGCCTATACAAAAGGTTTAGGAAAAGAAAACAATGGTGAGTCCCGGCCCTCTTCGAATTCACTGGCACCTCATGCAAGTGTAGGAAGGCACGCTGGATCGTCTATCTGATTCCAAAGCTGTCCTTTGCCATCTCATCCCTTGGCCTGCCCCCCAACCCTGAGGATGCCCCTGCCATCCCCCCAACCTCCTCATATTGCCTCTGAACCCAGATGGCAATCCATCCCGGTTCTCTCTGAGGGCCACGGGCTTGGGTAGTGGAAAGGGTGTTTGGGAAATTGTTAAATCAGTTACCCGTAGTAGAGCTATTTCTTGTACTTCTAAGTTTTCTAGAAGTGGAAGGATTGTAGTCATCCTGAAAATGGGTTTACTTCAAAATCCCTCAGCCTTGTTCTTCACGACTGTCTATACTGAGAGTGTCATGTTTCCACAAAGGGCTGACACCTGAGCCTGGATTTTCACTCATCCCTGAGAAGCCCTTTCCAGTAGGGTGGGCAATTCCCAACTTCCTTGCCACAAGCTTCCCAGGCTTTCTCCCCTGGAAAACTCCAGCTTGAGTCCCAGATACACTCATGGGCTGCCCTGGGCAGCCAGCATTCATTGTAAGTTCCCTCTTTGAAAACTGGTGTGTGGGTGTTCAGTTCTGTGTCTGGTGGGTATGGACAGACAGTAATCTCCTGTGATCTGTGCTAGCTGTGAGGCAGCTCTGGAACGTGAAGAGCTGTTTGGTTTGAACCGTGAACAAAACTGTGTTTTGAGTTTAGCTGACATTAAAGAAAAAAGTTCATCACGTGACTGTTAATGTAAACCTGGTTATTAAAATAACTATGAAATTAC