Transcript asmbl_58839

Sequence
Transcript Sequence for observation asmbl_58839 of TGE0006607:
GTTTCCGCCATTTTTGAAAATTGAGAAAGTCCGGAGCTAGGAGTAATTGCAGCCGCGATGGCAGCCTTTGCTGTGGAACCCCAGGCGCCCACGCTGGGATCTGAACCAATGATGCTGGGTTCACCCACATCTCCAAAGCCAGGGGTTAATGCCCAGTTCCTACCTGGATTTTTAATGGGGGATTTGCCAGCTCCAGTGACTCCACAACCTCGAACAATTAGTGGCCCTTCAGTAGGAGTAATGGAAATGAGATCACCTTTGCTTGCAGGTGGGTCACCACCACAACCAGTTGTACCAGCTCATAAAGACAAAAGCGGAGCTCCACCAGTTAGAAGTATATATGATGACATTTCCAGTCCAGGACTTGGATCAACACCTTTAACTTCAAGAAGACAGCCAAACATGTCATTAATGCAGAGTCCTCTTGTTGGAGTTACGACAACTACTCCTGGGATAGGGCAAAGTATGTTTAGTCCAGCAAACATTGGACAACCACGAAAGACAACGTTATCTCCTGCCCAGTTGGATCCTTTTTATACTCAAGGAGATTCTCTGACTTCTGAAGATCACCTCGATGACACATGGGTGACTGTGTTTGGGTTTCCTCAAGCATCTGCTTCCTATATATTATTACAATTTGCACAATATGGGAATATCTTAAAACATGTGATGTCTAACACAGGAAATTGGATGCATATTCGTTATCAATCTAAACTGCAGGCTCGGAAGGCCTTAAGCAAAGATGGGAGGATTTTTGGAGAGTCCATCATGATTGGTGTAAAACCATGTATAGATAAAAGTGTTATGGAAAACAGTGACAGGTGTGCTTTGTCATCCTCACCTCTGGCCTTTACACCACCAATCAAAACCCTAGGTACACCAACCCAATCTGGAAGTACTCCTAGGATTTCTACCATGAGACCTCTTGCTACAGCATACAAAGCTTCTACTAGTGACTATCAGGTCATTTCTGACAGACAAACGCCGAAAAAAGATGAAAGTCTTGTATCCAAAGCAATGGAGTACATGTTCGGCTGGTAGTGTAATAACAGCTAAGAACTGAACTACAAAGGAGGAGGCTGCTACACTAAAACAGTTAGCAGAGTACTGCCAGGTTTCCTTGGGTTAATTATATAACCACTCTCGGCAGTATTGGATAGCTATCTTATACTTTCTTTAGAAGCCTTTTTCTTTAAGGATACAACATATTTGTAGCTCGCACTTTAAAAGATGATTGAGATATGTTTTAAAGAAACAAAA