Transcript asmbl_13789

Sequence
Transcript Sequence for observation asmbl_13789 of TGE0000210:
CGGGGAGTGCGCCGGAAGAGGGGTACGGAAGTGCGCCGGAAGTGGGGTGCGGAGGTGTGCAGCGCGCTGTCAGACTGGCTCGCAGGCGGCGCGGCCGGCGGACCCGTTCGAGACAGCGCGGGCGGCTCGGGTCCCCTGGGGCTCCGCAGCAGGAGGACGCCATGGACGACAAGGAGTTAATTGAATACTTTAAGTCTCAGATGAAAGAAGATCCTGACATGGCCTCAGCAGTGGCTGCCATCCGGACGTTGCTGGAGTTCTTGAAGAGAGATAAAGGGGAGACAATCCAGGGTCTGAGGGCGAATCTCACCAGTGCCATAGAAACCCTGTGTGGTGTGGACTCCTCTGTGGCAGTGTCCTCTGGCGGGGAGCTCTTCCTCCGCTTCATCAGTCTTGCCTCCCTGGAATACTCCGATTACTCCAAATGTAAAAAGATCATGATTGAGCGGGGAGAACTTTTTCTCAGGAGAATATCACTGTCAAGAAACAAAATTGCAGATCTGTGCCATACTTTCATCAAAGATGGAGCGACAATATTGACTCACGCCTACTCCAGAGTGGTCCTGAGAGTCCTGGAAGCAGCCGTGGCGGCCAAGAAGCGATTTAGTGTATACGTCACAGAGTCACAGCCTGATTTGTCAGGTAAGAAAATGGCCAAAGCCCTCTGCCACCTCAACGTCCCTGTCACTGTGGTGCTAGATGCTGCTGTCGGCTACATCATGGAGAAAGCAGATCTTGTCATAGTTGGTGCTGAAGGAGTTGTTGAAAACGGAGGAATTATTAACAAGATTGGAACCAACCAGATGGCTGTGTGTGCCAAAGCACAGAACAAACCTTTCTATGTGGTTGCAGAAAGTTTCAAGTTTGTCCGGCTCTTTCCACTAAACCAGCAAGACGTCCCAGATAAGTTTAAGTATAAGGCAGACACTCTCAAGGTCGCGCAGACTGGACAAGACCTCAAAGAGGAGCATCCGTGGGTCGACTACACTGCCCCTTCCTTAATCACTCTGCTGTTTACAGACCTGGGCGTGCTGACACCCTCAGCAGTCAGCGATGAGCTCATCAAGCTCTATCTGTAACCTGTGAGCCCTTTCCTGCCAAGGTGCAGCTTACGTAGTTGAGGCAGGGTGAGTAGCTGCTTGACACCCCAGTGAGTCAGGCCAAAACTGAGATGTGTTTAATGAAGATTTATGGAGTAAGGACTTAAAATCATACATCTTGGAGAACCTTTCTTACTCATTTCAGTCCCATCTAAAAATGTGTCAGCTATTCTAAATCCCAACTTAAATTGTTCTTACGGTTTCTAGAAACTTTCCTTTTCAGTTTCCAGAAATACAAGTTAGATAATTGGCTACTTAACTGATGAAAGATGAGCCCAAGTCCACCTGTCTTCATCCTCCCCTGCACTCCAGACTGATCTGCCTAAAGCACGCGAGATGCAGGCGAAAAGCAGCCACACCCCTCTGCCACAAATGACCAACAGCTGGTCAGGACGTTACACGCGGTGCCTTGTAAGAGGCAAGAAACACTTGCTGAATCTGCATCTGGCTTCCAGTGGTAAGCACATTCCTCAGCAGGATCAAGCCAAACAGTAAAAACTACCAAGAGAACACGAGGAAGGCAGAAACGATGTTTAGCAACAGTATTCTGCATGGTTCACTGCTTAAGAAAATGCCTTCTGGAATATTTGTAAACTGAAATTCTGTATGTGTAAGAGATGTTTAAATATGTTTGGGTCCTAAACAGCTTTTTAAAATTATACTTGGGAATAAATTCAGCATCTTTTCAAATAAACTCTATGAAAGACG