Transcript asmbl_58471

Sequence
Transcript Sequence for observation asmbl_58471 of TGE0016851:
CAGCTCGGCCCTGCTCGCTCACTCGCTCGTCCCCGGCTTCCGAGCACAGCATGGCGGTCAAGGTGCAGACAACCAAGCGAGGTGATCCTCATGAGTTAAGAAACATATTCCTGCAGTATGCCAGTACTGAGGTTGATGGAGAACATTACATGACCCCAGAAGATTTCGTCCAGCGCTATCTTGGACTGTATAATGATCCAAATAGCAATCCGAAGATTGTGCAGCTCTTGGCAGGAGTAGCCGATCAAACCAAGGATGGATTGATCTCCTATCAAGAGTTTTTGGCTTTTGAATCTGTTTTATGTGCTCCAGATTCCATGTTCATAGTGGCTTTCCAGTTGTTTGACAAGAGTGGAACTGGAGAGGTGACATTTGAAAATGTCAAAGAAATTTTTGGACAGACTATTATTCATCATCATATACCTTTTAACTGGGACTGTGAATTTATCCGACTGCATTTTGGGCATAATCGAAAGAAGCATCTTAACTACACAGAATTCACACAGTTTCTCCAGGAGCTACAATTGGAACATGCAAGACAAGCCTTTGCACTTAAAGACAAAAGTAAAACTGGCATGATTTCCGGTCTGGATTTCAGTGACATCATGGTTACCATTCGGTCTCACATGCTTACTTCCTTCGTGGAGGAGAACTTAGTTTCAGCAGCTGGAGGAAGTATCTCACACCAGGTTAGCTTCTCCTACTTCAATGCATTTAACTCCTTACTGAATAACATGGAGCTTGTTCGTAAGATATATAGCACTCTAGCTGGCACAAGGAGAGATATTGAAGTCACAAAAGAGGAATTTGCCCAGAGTGCCATACGCTATGGACAAGTCACTCCATTAGAAATTGATATCCTATACCAGCTTGCAGACTTATATAATGCTACAGGGCGCTTGACTTTGGCAGATATTGAGAGAATAGCCCCGTTGGCTGAGGGGGCCTTACCTCACAACCTGGCAGAACTTCAGAGACAGCAATCTCACGGTTTAGGCAGGCCTGTGTGGCTCCAGATTGCCGAGTCTGCTTACAGATTCACTCTGGGCTCAGTTGCTGGAGCTGTGGGAGCCACTGCAGTATATCCTATAGATCTGGTGAAGACGCGCATGCAAAACCAGCGTGGTACTGGCTCTGTTGTGGGGGAGCTGATGTACAAAAACAGCTTTGACTGTTTTAAGAAAGTCTTGCGTTATGAGGGCTTCTTTGGACTCTACCGAGGTCTGATACCACAGCTTATAGGGGTTGCTCCAGAAAAGGCCATTAAACTGACTGTTAATGATTTTGTTCGGGACAAATTTACTGGAAGAGATGGCTCCATTCCACTTTTTGCAGAAATCCTTGCTGGAGGTTGTGCTGGTGGCTCTCAGGTCATCTTTACCAACCCATTGGAGATAGTAAAGATTCGCCTGCAGGTAGCTGGAGAGATCACTACAGGACCCAGAGTCAGTGCCCTGAATGTGCTCCGAGACCTGGGACTTTTTGGTCTGTATAAGGGTGCCAAAGCGTGTTTCCTCCGAGACATTCCCTTCTCTGCAATCTATTTTCCTGTTTATGCTCATTGCAAAATACTTCTGGCTGATGAAAATGGACACGTGGGAGGTCTCAATCTCCTTGCAGCTGGAGCCATGGCAGGTGTGCCTGCTGCTTCTCTGGTGACCCCTGCTGATGTCATCAAGACAAGACTGCAAGTGGCTGCCCGTGCTGGCCAGACGACATACAGTGGTGTCATCGACTGTTTCAGGAAGATACTCCGGGAAGAAGGGCCCTCAGCTTTTTGGAAGGGGACTGCAGCTCGCGTGTTTCGATCCTCTCCTCAGTTCGGTGTTACCTTGGTCACCTATGAACTTCTCCAGCGGTGGTTTTACATTGATTTTGGAGGCCTCAAACCCTCTGGCTCAGAACCAACACCTAAGTCACGCATCGCAGACCTTCCTCCTGCTAGTCCGGATCACATCGGTGGATACAGACTCGCCACAGCCACTTTTGCTGGCATTGAAAACAAGTTTGGCCTTTATCTCCCCAAATTTAAATCTCCTAGTGTTGCTGTGGTTCAGTCAAAGGCAGCGACAGCAGCTCAGTGATGACATAACTGTTGAGTGTGGCAAAACGGCACCCTGGAGAGGCCTAGGACAGCAGCCCTGTAATGTATCTAGTCAGCTGCATGGTGCTGACTGAGCTGAGGAGTCAAACTATTCTTTCTATATGACATATACATATACTTGTTTATAAAGTAATCATCTGCCCAGGAAAAAAAAACACAATGCAGTTTCAAGCTTTAGTCTTACATGTTAAAATGTTTTCCAAGCCTTGGCATGAATTAGTGTTCTAGACTGCTTTGCACAGCTTGCACTTATAGTGACTGTACATATTGTACATCTTTGTACAGAGACATCTTGGCACCTCATCCCAACCACATTTATAGAATGAAATGCAGTTCTGAGTGGCTTGAAATGTACAGAATGTTTTGAAAGTGTTTTATTAAGAATCACACGAAAATAAATGTATTACAATTAAATTCATTCCTATTGGTGACTTATGGACATGAAGCATCAATATTGGATGTATTTAATTCTTAATTTGTTTTCCATTCTGGAATAAAAAAGTATCTGCTGATAAGAGGTATAACAAGACCAGTGCTAACACCATTGAATAATAGATCCTTTGGAAAAGATGCATGCCAGTGGATGCCAGAGGACCAGGCTAATGACTTGCGTGTGCTGATGTGTTTCCATTTGTATTTAACGTGTGTGTAGATCCTCCCCTGTTCATCAATCAAAAGGCATTTTCTAGACAGCTCCTCTCCTGTCAGTGTGCATATGCAAAGAGGGACGTCTCCAGCATTACTGGCTTAGTTTCGCCTTCCTCTGACACAGCAAGGCAAGGGCCTAGCTTTCAAAAAAGTAAAGGATACTTTGGCAATTTTCCTTCATATGGATATGATT