Transcript asmbl_58378

Sequence
Transcript Sequence for observation asmbl_58378 of TGE0006524:
GTCGGATCGGAATTGGACTTGGGGTGCGCCGTGTGGAGTCAGGCATAAAACTTGTTGGAGGGGAGTAACGAGCCTGCTCCTCCAGCTCTCCTCATCTGTGCGGGTTCCCACCAGCCTTGCGATTTATTTTTATATCTGCTTTTTTTATATATAGAGAAATATATATACATATATATTTTTTTCCCCATAAGAGAAAATTTCTGTTCCAAGAGAAAATAAGGCAAGATCAATGAAGGAGAGAAGAGCCAGCCAGAAATTATCCAGTAAATCTATCATGGATCCTAATCAGAACGTGAAATGCAAGATAGTAGTGGTGGGAGACAGTCAGTGTGGGAAAACCGCGCTGCTGCATGTCTTCGCCAAAGACTGCTTCCCCGAGAATTACGTCCCTACAGTGTTTGAGAATTACACGGCCAGTTTTGAAATCGACACACAAAGAATAGAGTTGAGCCTGTGGGACACTTCGGGTTCTCCTTATTATGACAACGTCCGGCCCCTCTCTTACCCAGATTCTGATGCCGTGCTGATTTGCTTTGACATCAGTAGACCAGAGACTCTAGACAGTGTCCTAAAAAAGTGGAAAGGTGAGATCCAGGAGTTTTGCCCCAACACCAAAATGCTCATGGTTGGCTGCAAATCTGACCTTCGGACAGATGTTAGTACATTAGTAGAACTCTCAAATCACAGACAGACACCAGTGTCTTATGATCAGGGGGCAAACATGGCCAAACAGATTGGAGCTGCCACTTATATTGAATGCTCAGCATTACAGTCGGAAAATAGCGTCAGAGACATTTTTCATGTTGCCACTTTGGCATGTGTAAACAAGACAAATAAAAACGTTAAGCGGAACAAATCACAGAGGGCCACAAAGCGGATTTCACATATGCCCAGCAGACCAGAACTCTCAGCAGTTGCTACGGACTTACGAAAGGACAAAGCGAAGAGTTGCACCGTGATGTGAATCTCCCGTTATCTTTAATGAGGACAAGGAAATCTAGTGTAAAAAAACACCACAACAAAACAAAAAGGTGAAGTCTGAATGAAGTGCACAGCCAAAGTCACATATTCTGGAGGCTTAGGAGGCATTTGAAAGGATGCTCATCTTTTTGGAATCCTGTCCTTAGGTTCGGCATGTAGAACAAGTGGTGAAAAGTGAATACATTGAAGTGTTCTGAAGTGTGACTTGAAAAATATGCCAAAAAAGAGAGATTCAGATGGTCTAGAGGTAGATGAGGAGGAATGCGAGTACCTCCAAGAAGAAAAATCCCGCTCTGAATGGTGCTTGTGTTATCGTTTTCTTTGTTGTAATCTATTCATGAATCTCTACTTTGATTTAATTTTTAAATGTTTTAATCTCCTTTACAAAAAGTATATATTAATATACCGTCCTCATTGGGGAACTGGCACTGTGACCTTAGCATTTAGTTTTCTAGAGGATGTGATCTAATTTCCTCCTAGCTCATCATTAAAATGGAAATTATATCAGGACCCATGGGATATCCAGAGGAAAAGTTTGTGAGGCTTTGAAATCTTGCCTTCCTGAAGAGAGCTGAGCGAGATGGTTCTAAAGAAAGGCTTTTGCGGTCTTGCAAGATATGCAGACGGGCACTACAAAGATCGAATAGATTGAATAGAAAAATGGTGTCGATTTTTATTCAGTCTGATGGTTCTGTTCATCATTGTGATTGTCATTAAAAAGTGGTAAATTGCTCAATGTAATATTTTTGTGCGCTGTTTAGAAAAGAGGGTTGTGATTTTTTTGCCATCGTTGATGAAAATGCAAAGTCAAATAAAAGGTGTCTTGGTTTGGTGTCATAGAATGATCCAAGGGGAAAAAAATGTAGGTACTATTTTCACCTGAAGAGATAAGGAATGAAGGAATAGTAGCAGAAAGCACAGTTTGTGAGTAAGCGGTCTGGAATTAACTTACCAAAAGTACAAAGCAAAAGGCCTATTGTTTGGGAGGTGAAGCTCTAAAGCTGGCAGCATCTGATGATCTGTTGGTTTATTTCGTTTTACTTAAATGAACATGACAAGAGAGGGATCCTCTTGTCCAAGCCTTAGAGAATTTTTAGAGAGAAATTATGTAATGTCCATTCTGACACTATGCTAGCCGTTTCTAAAGAGTGATTGCTAAACCTCACTTAACCAGATTCTGCCAAGGCCCGTGTTCAATACTTGATTGCAGTTACATAAAATAATCAACATTTAAAATAGTTTACAGATATTTTTCGACCAGTTCCTTTTAGAGTTTCTTTCAGAGAAGAAACCAGATCTGACCTGTTTATTGTTGGCGCTTGTTGAAAACGAGCTTTCTTTCCAATGATAAAGCTTCATTTTTGAAGTGTTGAAGCTGTGCTCCCATTAAATTGTGGCAGGAGAGGAGATTAAGATAATTACAACACTTAGTTCTATGTCTTACAAGCACTTTGTTTTGTCTCTGCAAGAAAATACCATTCCAGCCATTTCTCATGAAATAACAGACGTTTTACCAACATAATATGCTTTGACTGATGCAGCATTATGCTTTGGGCAGTATTACAAAATAGCTGGCAAGTGCTTTCTGTATTTAAATATTGTAAAAAGAAAATAAGTTATAACTGTTATAAAGCAGAACTTTCGTTGCATTTTTTAAAATGTTGAAGTCAGTTTGTATGTTTGGTCAATGTTTCCGCAGTATTTATTAAAACATACTTTTTTTTCTTCAAATAAAAAAGTAACCATGTCTTTGTCTAAA