Transcript asmbl_5822

Sequence
Transcript Sequence for observation asmbl_5822 of TGE0006556:
CCACCCCCTCTGCAGCTGAAGGCTTCCCCTCCGTCAGTGACAGAGCCTTCGGGTGCGTGATCACTTGTGGTTCTGCACCTCGCGCGTTGGCAGGCACTGTTTTCTTTGCCTTCATGAAACTTGCCTTCTGTGGAGTGATACAGACAGTAAACAAGTAAATTAACATGATGGATTTCTCCAAGCTACCCAAAATACTCGATGAAGATAAAGAAAGCACATTTGGTTATGTGCATGGGGTCTCAGGACCTGTCGTTACCGCCTGTGACATGGCAGGTGCAGCTATGTATGAGCTGGTGAGAGTGGGCCACAGCGAGTTAGTTGGAGAGATTATCCGATTGGAGGGGGATATGGCTACTATCCAAGTGTATGAAGAAACCTCTGGTGTGTCTGTCGGAGATCCTGTACTCCGCACTGGTAAACCCCTTTCAGTAGAGCTTGGTCCTGGCATTATGGGAGCCATTTTTGATGGTATTCAAAGACCTTTGTCCGATATCAGCAGTCAGACTCAAAGTATCTACATTCCCCGAGGAGTAAATGTGTCTGCTCTTAGCAGAGATATCAAATGGGATTTTACACCCTGCAAAAATCTACGGGTTGGTAGTCACATCACTGGTGGAGATATTTATGGAATTGTCAATGAGAATTCTCTCATCAGACACAAAATCATGTTACCCCCACGAAACAGAGGAACCGTAACTTATATTGCTCCACCTGGAAATTACGATACCTCTGATGTTGTCTTGGAACTTGAATTTGAAGGTATAAAGGAGAAGTTCAGCATGGTCCAAATATGGCCTGTACGTCAAGTTCGGCCTGTCACTGAGAAGCTGCCGGCTAATCATCCTTTGTTGACTGGCCAGAGAGTCCTCGATGCCCTTTTTCCATGTGTACAGGGAGGAACTACTGCAATCCCTGGGGCTTTTGGATGTGGAAAGACGGTGATATCACAGTCTCTATCCAAGTATTCCAATAGTGATGTAATCATCTATGTAGGATGTGGTGAAAGAGGAAATGAGATGTCTGAAGTCCTTCGTGATTTCCCAGAGCTCACTATGGAAGTTGATGGTAAGGTAGAGTCAATTATGAAGAGGACAGCTTTGGTAGCCAATACCTCCAACATGCCTGTGGCTGCCAGAGAAGCCTCCATTTATACTGGAATTACACTGTCAGAATATTTCCGTGACATGGGCTATAATGTTAGTATGATGGCTGACTCAACCTCTAGATGGGCTGAGGCCCTGAGAGAAATCTCTGGTCGCTTAGCTGAAATGCCTGCAGATAGTGGATATCCTGCATATCTTGGTGCCCGTCTGGCCTCTTTCTATGAGCGAGCAGGCAGGGTGAAATGTCTTGGAAATCCTGAAAGAGAAGGGAGTGTCAGCATTGTAGGAGCAGTTTCTCCACCTGGTGGTGATTTTTCTGACCCAGTTACATCTGCTACTCTTGGTATTGTTCAGGTATTCTGGGGCTTAGATAAGAAACTAGCCCAACGTAAGCATTTCCCCTCTGTTAATTGGCTAATCAGCTACAGCAAGTATATGCGTGCCTTGGATGAGTACTATGACAAACACTTCACAGAATTTGTTCCTCTGAGGACCAAGGCTAAGGAGATTCTGCAGGAAGAGGAAGACCTGGCAGAAATTGTGCAGCTTGTGGGAAAGGCTTCTCTAGCAGAAACAGATAAAATCACTCTGGAGGTAGCCAAACTTATCAAAGATGATTTCCTACAACAAAATGGATATACTCCTTATGACAGGTTCTGCCCATTCTACAAGACAGTAGGGATGCTGTCCAACATGATTGCATTTTATGATATGGCCCGTAGAGCTGTTGAAACCACTGCCCAGAGTGACAATAAAATCACATGGGCCATTATCCGTGAGCACATGGGGGAGATCCTCTATAAACTTTCCTCCATGAAATTCAAGGATCCATTGAAAGATGGTGAGGCAAAGATCAAAGCAGACTATGCACAACTTCTTGAAGATATGCAGAATGCATTCCGTAGCCTTGAAGATTAGAACTGTGATTTCTTTCTTCCTTTTCCTCAGCAAGTTCTCATGTGTGTATATTTTCCTAGATCTCATCTCAGACCCTTTGCTTTTTTATTGTGCAGCTTTGAGATTCGTGCCTATATGTGTTATCATTTCTTTTCCGGTTTATTTGGTAGGTCTTATATAAAGCAAACATTCCTTTGTTCCAGTGTTTGAAGGGCCTCCTTGATCCTTTCTCCAAAGTGGTGAATGTAGTAAATATGATATACTCTGGCTACACTACTGTAAACTTGTGTGTAGAGTCATGTCCCTCCTTGTCCTAGGTTTGCCCTTTCCTTATCGCCATTACATTGTAAACAGGACTACTGCATGTACTTTGCAACAGATTTGGAATGAAAGGCCAGATTTCTATACATTTTGCCAGGTACTTTATAAAGTGACTTGATATCTATCTACATGTCAAGGTTATTTGCAGTTTAGCATTTTACTAAGTAACTGCTTTGCAGGAAATGTTTGCTTTTTTAAAAAAGATGAATGATTAACGTTCCAATTATGCATTGCTTCCCCACTATATATCAGGAATATTTATGGGAAACTGTTGGGGACTATACTGTTTTTAAAAGTCTTTTGTGGGGACTCAGCACAATATATGAATCAGTACCCTCTAAAAAAGTAAAAAAAAGGGGTCAGATGGTCAAATTTAGATTAATGTCATCTTGTTAAACCTTATTTTGTTTCACTAGGAAAATTTCAGTATCAAGGAATAGTCTACCGCATTACTAGGAAATTCTCTTTTAAATTACATTTAGAACAATCACTGAAAACTTAATCCACATCATATCCTTTTCCTTAAACATCTTAGAAGCTTAAGCTTCTAAGAATCATGTGGCAGCGTGATGGGCAATAAAATGTCACAAAGAAGATATTTATTAATGGTTAAAGGCTCTTTGCACCTTTAAGGACCAGCTGAGCTGTACTGATTCTTGGGGCCAGAGTGGCATTATGTTTTTACAAAATGACATGTGTCACATGTTTGCATGTTTGTTCACTTATTGAATTTTTGAACAAGCAGTTTACCAATTGTAGACGTAATATTTTCTTTCATGTGGGTTTTGATTCACTGGCTCAAGAGTTCTCAGAATATCTGTAGCCATAGCAGCTTACCAGTTTCCATTTGGTTTAATAGGGATAAATTAATTTTTGTGTCTGCTGATGGCAGAATCTAGGTCATGTGAAGAAAGATTATTTCGTCCTATCTTTGAAGTATATATTTTAAAATAGTAGTTTCAGTGTTTGTACAATAAGGTACACTGCAGAACAGCTTTGAGAGCAACAGTTTCCCATTAACTTTTTCTGACCCATAGTGCTGGCATCATCGCTTCCTCTTTGGGAAGAGGAAGGGTGTTGAACATATCTAACAATCTCAAATACCTAAATATAATAGCATAAATAAAGTATTTATTTTATGCTTCAGTATGTTATTATTTAAATTTTTAGGTAATGTATTTCTTTTGGTCTGTTAAGGAAAGATGCAGTCAGAGAATTCAGCTGTAGGTTTTTTTAAATCCTTGCAGGTTGATGCTCTTACTGTGGACTACTATTCAGGACAGAGGTTCTTCCATACAACTTTTTGTAACCTTTCAGAGCACTGGAAGATAAAAATTTTACAATGATCTCTTGAGATGTGAATTTAATGGTGCTGCTTAATCAGTTTGCTTTCAGTGTGGCCTCCTGCCCAGAGATCTTAAGACCAGTGGAAATTAAAAGGATTTAAAAACTTTCTATTTCTACCTTAAACTTACCAGCACACTAGGTGGTGATGAATGATATGACAAAGAAAGCTTGACCAAGTTTGTTTTTTTGTCGTTCCAAATTTGCAGTGTACACTCTTACTCTTTTTTAAGAATGTTGATATATGGGTGTGGAGATGCTAGAGAAACTATGCTCAGATATTCAGTAGAAGTGTTCCTTCAGCTATGTTAAGAATTTCATATTGGTCACTGATCATATTTCTTTAGTAAGAATGTGTTAAAATTACCACAGTCTTTTAAAAAGATGATGCAGTTCTATATTTATTGTGCTGTGCCTGGTCCTAAGTGGAGCCAGTTAAACAAGTTTCATATGTATTTTTCCAGTGTTAAGTGTCACACATTGTACCCTTTGGAAATTTCCTGCCATCCCAAGGAATGAATAGAAGAGACCATATATATTGCCTCCATATCCTTGAGATTTCATTATCTTTATGTTAACAGTTGTGTATAATTGTTAAAATCTATGAAAGAATAAAAAGTGGATTTAAATTAA