Transcript asmbl_44010

Sequence
Transcript Sequence for observation asmbl_44010 of TGE0002143:
TGATGTCACAGGCCCCATGTGAGCGGATTGCAACACATGCAGCTGCCTGGAGAGAGGGAGCCGGTGTCCTACGTCAGAGCCGCCGCCGCCGCGGAGCCGCCGCCGGGGAGGAGCAGCCGCTGCCGCCCAGGACTGGGCCCTTAGGGAGGAGGAGGCGAGAAGATGGCGGACGACCCCAGTGCTGCCGACAGGAACGTGGAGATCTGGAAGATCAAGAAGCTCATTAAGAGCTTGGAGGCGGCCCGCGGCAATGGCACCAGCATGATATCATTGATCATTCCTCCCAAAGACCAGATTTCACGAGTGGCAAAAATGTTAGCGGATGAGTTTGGAACTGCATCTAACATTAAGTCACGAGTAAACCGCCTTTCAGTCCTGGGAGCCATTACATCTGTACAACAAAGACTCAAACTTTATAACAAAGTACCTCCAAATGGTCTGGTTGTATACTGTGGAACAATTGTAACAGAAGAAGGAAAGGAAAAGAAAGTCAACATTGACTTTGAACCTTTCAAACCAATTAATACGTCATTGTATTTGTGTGACAACAAATTCCATACAGAGGCTCTTACAGCACTACTTTCAGATGATAGCAAGTTTGGATTCATTGTAATAGATGGTAGTGGTGCACTTTTTGGCACACTCCAAGGAAACACAAGAGAAGTCCTGCACAAATTCACTGTGGATCTCCCAAAGAAACACGGTAGAGGAGGTCAGTCAGCCTTGCGTTTTGCCCGTTTAAGAATGGAAAAGCGACATAACTATGTTCGGAAAGTAGCAGAGACTGCTGTGCAGCTGTTTATTTCTGGGGACAAAGTGAATGTGGCTGGTCTAGTTTTAGCTGGATCCGCTGACTTTAAAACTGAACTAAGTCAATCTGATATGTTTGATCAGAGGTTACAATCAAAAGTTTTAAAATTAGTTGATATATCCTATGGTGGTGAAAATGGATTCAACCAAGCTATTGAGTTATCTACTGAAGTCCTCTCCAACGTGAAATTCATTCAAGAGAAGAAATTAATAGGACGATACTTTGATGAAATCAGCCAGGACACGGGCAAGTACTGTTTTGGCGTTGAAGATACACTAAAGGCTTTGGAAATGGGAGCTGTAGAAATTCTAATAGTCTATGAAAATCTGGATATAATGAGATATGTTCTTCATTGCCAAGGCACAGAAGAGGAGAAAATTCTCTATCTAACTCCAGAGCAAGAAAAGGATAAATCTCATTTCACAGACAAAGAGACCGGACAGGAACATGAGCTTATCGAGAGCATGCCCCTGTTGGAATGGTTTGCTAACAACTATAAAAAATTTGGAGCTACGTTGGAAATTGTCACAGATAAATCACAAGAAGGGTCTCAGTTTGTGAAAGGATTTGGTGGAATTGGAGGTATCTTGCGGTACCGAGTAGATTTCCAGGGAATGGAATACCAAGGAGGAGACGATGAATTTTTTGACCTTGATGACTACTAGGTAGTCGACATGGGTCCGGCAAAACGTGCCTCACCCTCCAGCATCCAACCCAAGGAGCATACCCATGGTGGAATCCAAACAGATCCCTGCCTTACAATTGGAACATTTCCAGAACTTAATCCATGAGCATTGGATATTGAAAAGAAAACCGAAACAAAACCAGACCCAGCCCTACACTTTGGTTTGTCATGGTGTCAGCGCAGCAGCCTACAACTAAGTTCCTAAACGCCACTTTGGACTAATTTAAAAAAGAATCCCAGTTTTTACTTTTACTGGATGGTGAAATTGGTTGCTCTTGTATTTTATGAAAAAAAATGATTTTTTTAACCTTCATACATAGAAGCAAAAATACTTTAACTGCTGTAAACCTTCAAAAGTTAATAGAAGTGAGATCATACTGGTTTGTTTCTTATTTTGATTGGAGAAAAATTAAATTGCTGCATTTCGCAGTGACCCATTTACATGGCATTCTCAGCTTAGACTGCGTAAGAAGAAATATATGTGGTGAAATGTTGGAACCATTTCTCTCTTGGTCTCTGTTTAATGTTGAAAGGGTGAGCTAATAGGAGGCACTTTCAACTTCACTCCCTCACGCTACCCCGTCCCCCTCCAGACTGGCAGTTTCAAGGATGCAAATTGCATTGCAAAATCAAACTGACTCATGAAGCATTTGGGCCAGTGCACTGTTTACTTCCATCTGTTTGCAGACACATTTGTGCCCGGCGTTTGGGAGCCCTTTGTATCAATGTTCTGACAAGGGTCCCTATAACCTTAACCTACTCGAAACCGGTTTGGGATGGATATGATGGGGCTTCTGTGCTATTGCTGGGATTGGGAGAAATAAAACATGCAATTTAAGTGGAAGCGAAGAAATTTAAAGAGGATTTTATTTTGCTTGGGTCAATCCTTGTTAAAAGGGAGGTGGATGTGTTTTCCTTGTGTTGGATGGCATGAGATTATGTGAATGTTTTGATTTATTAAAATGAACTGCAAGGTTTTTCACAGGAACGACAGACATGTATGACTGCATGTAATTATAAACTCCTGACCTCCTGGTGGGGTTGGAGCATCTGTTTCAAATGTGGGACTTACAAGCACTTCTCACATGAGAAATTAGGGGCGGGTGGGAAGGGATGGGACACAGCTTCTGGCACCATGGATTTAAGACCATGTTGGATCCAAAAGTTGGCCTGAAACCCTGAAGCTTATGCTTCACAGCTGGGCTGTAAGTCAGACTTGAACCCAGCTGATATGCAAGGTCATGGCGTGCCCAGGGTGGTGACAGTTGAACAAAGTGTATAGTACGTGCCCAGTGGTAGCGATGGAAAAAAGTATACCAAATGGACTTTGAAGGACCAAAGGTTTTAAAAGTCAATTGGTATCACCTCCACACTGACTAGGGTAGTGGGGTGCATTTGGTTTTCAAATTGGGTACTTTTAACACTTTAGTGCCTGACTGCTGTTCTTTACTGACTTGATTCAGTCACTCGTAGCTTTATTGGTCTGAACCAGCTCCTTGTTCCCAGGTTACAGACCTGCCTATCGTTCCAATAATCCTGTTTCACTTGAATGAAGGGAGTATGTCTTAAATGTAAAGTTTCTGGTTCTCACACTGTACTCTGAGGTCCAAATACTGTCTGTCAATGTGTAACCTGATGTCTCAACCCCCTGTGAGAAGAGTCCATTATTTGGTGTTCACCAACGTGGGAGACTTCACCGGAACAGGCTTTTTTGCTTTGGGCTCTGCTATTTGTTTGCAGAACACCCAAGAGCGAGCAAACATGCTCTCTTCACAGCAGTACCTTAGGGTTTTGCCATTGTAAATGGGTCTGATGTGATATGACAAGACCAGAGAAATTGGATGTAAATTTACATTTTTGAATATGCTTGTTGTTTCACATGATACATTTAGGGTATGCAGCTCCTTTTGTAGTTTTTATTTTTACTATTTAAGTTTGGAAATGATGCCAAATTTTTGTATTTCTTTAATCAATGTGTTCTCTTCGGTGATATATATTGCATTATATATTGATGTGTGTATCAATATATATTGATATGTATTACACTTACACATACAAACACATATAAGAGGGGGTGAAAACCGTAGCCTTTGCATTCTCTATAGCCTCTGCAGAGAGATACTAAGCAGCAAAATCTTGGTGTTGTGATGTACAGAAATGGAGAAGAGTATTAAACCATATTTAAGAATA