Transcript asmbl_57855

Sequence
Transcript Sequence for observation asmbl_57855 of TGE0006472:
CACGTTAGGAAGCCCGGCCACGGCCTGACTCCGGACAGGGCGGACGGGGTGCTCTGAGCTGTGGCCATCTGCCCGCATGAATGTTCTGAAGCCATCCTGTCCCTGGAGAAAACAGGGGTGAGGAGGAAGAACAGGGACTCGTGTGCCAGGAAGAACTCGGAGCCAGGAAGCCCCATTTGCTGGAAACACCAAGAGATGTGGCCCCCCTCACAGGGCCTGAATTTCCTGCTGCTATTCACAAAGATGCTTTTTATCTTTAACTTCTTGTTTTCCCCACTTCCAACTCCGGCACTGATCTGCATCCTGACCATTGGAGCTGCCATCTTCCTATGGCTGATGAACAGACCTCAGCCAGTCTTGCCTGATATTGATCTGAACAACCAGTCAGTGGAAATTGAGGGAGGAGCACGGAGGAGCGCAAAACAGAAAGACGACGAACTGCTCTCTTACTACTTCTCAGATGTCAAGACAATATACGAAGCTTTCCAAAGAGGACTGGTTGTATCTGGCAATGGGCCTTGCTTGGGATATAGAAAACCAAATCAGGACTACAGATGGCTGTCCTACAAACAGGTGTCTCATCGAGCAGAGTACCTGGGCTCCTGTCTCTTGCATAAAGGATATAAGCCATCACCAGACCAATTTGTTGGCATCTTTGCTCAGAATAGGCCAGAGTGGATCATCTCGGAGTTAGCTTGTTACACGTACTCCATGGTGCCTGTCCCCCTGTATGATACCTTGGGAGTAGAAGCTGTCGTGTACACTATCAACAAGGCTGATATTGCCATGGTGATCTGTGATACACTCCAAAAGGCATTGGTCCTGATAGGAAATGTGGAGAAGGGCCTCATCTCAGGCCTAAAAATAATCATCCTCATGAATTCCTTTGAAGATGACCTGAAGCAAAGAGGGGAGAAAAGTGGAATAGAGATCTTATCCTTCTCTGAAGCTGAGAATATAGGCAGAGAGAACTTCAGAAAACCCGTGCCACCTACACCAGAAGATCTGAGCATCATCTGCTTCACCAGTGGAACCACAGGTGAGCCCAAAGGGGCCATGCTAACCCATCAAAATGTCATTTCAAATGCTGCTGCTTTTCTCAAACTTTTGGAGGACAGCTTCCAGCCCACTCCCAAGGATGTGACCATATCCTACCTCCCCTTGGCTCATATGTTTGAGAGGGTTGTACAGGTTATTATGTACTCTTGTGGAGCCAGAGTTGGGTTCTTCCAGGGAGATATTCGGTTGCTGCCCGATGACATGAAGACTCTGAAGCCCACGGTGTTTCCCATAGTGCCTCGACTCCTTAACAGGATCTACAATAAGGTTCAAAATGAAGCAAAGACACCCTTGAAGAAGTTCTTGTTGAACTTGGCTGTTGCCAGTAAAATCAATGAAATGAAAAAGGGTATCATCAGACGCAACAGTTTCTGGGACAAGCTCATCTTTGCAAAGATCCAGGACAGCCTGGGTGGGAAGGTCTCCTTAATGATCACTGGAGCTGCCCCCATCGCCTCTCCTATCTTGACATTCTTCCGGGCAGCAATGGGATGTATGGTGCTTGAAGCTTATGGACAAACGGAATGCACTGCGGGCTGTACATCTACGTTACCTGGAGACTGGACGTCAGGCCATGTTGGAGTCCCTGTACCTTGCAATCACGTGAAGCTGGAAGATGTGGCTGACATGAACTACTTTTCGGCAAACAACGAAGGAGAGATCTGCGTCAAGGGAAGCAGTGTGTTCAAAGGATACCTGAAGGACCCTGAGAAGACAAATGAAGCCCTGGACAAGGACAACTGGCTTCACACAGGAGACATTGGTCGCTGGCTCCCGAATGGAACTCTGAAGATCATTGATCGAAAAAAGCACATTTTCAAGCTGGCCCAAGGAGAATACATTGCTCCAGAGAAGATAGAAAATATCTACATCAGGAGTAAACCTGTGCTGCAAATTTTTGTACACGGGGAAAGCTTATGGTCATTCTTAATAGCAGTGGTGGTTCCTGACCCAGACGTACTTCCCTCATTTGCAGCCAAAATTGGGGTTAAGGGCTCTTTTGAAGAACTGTGCCAAAACCAAGTTGTAAAGGAAGCCGTTTTAGAAGACTTGCAGAAAATTGGGCAAGAAAATGGCCTTAAAACCTTTGAACAGGTCAAAGACATTTATCTTCATCCGGAGCCATTTTCCACTGAAAATGGGCTCTTGACACCAACACTGAAATCAAGGCGGGAACAGCTTGCCAAGCACTTTCAGACACAGATCAACAGCCTGTATAAGGACATCTAGGAGTAGGCTAAGGTACTGCTGGGAGGGGCTCAGTAGTATGTCTTGTGGGAATATGACTTAAAAACTAGTCTTATGTTCACTACTTGTCTTTCT