Transcript asmbl_56950

Sequence
Transcript Sequence for observation asmbl_56950 of TGE0006437:
GGTTTGCCTGCAATGAAAGTTCGTTCTCTACAGCTAAAGGACATCCTTTCTGAGCTGCTGTGAATAAATTTGGAATGATACTGTATATTTTCATCTAATGGAGAATTAGCTATACCTTGAAAAAGGATTGCTGCACTGGACAACTTCAGACTATTGCTCACAATGTCATCAAACAGGAGTCAGAATCCCCATGGACTGAAGCAGATTGGCCTTGACCAGATCTGGGACGACCTCAGAGCTGGAATCCAGCAGGTGTACACCAGACAGAGCATGGCGAAATCCAGATACATGGAACTCTACACTCACGTTTATAACTACTGCACGAGTGTTCACCAGTCAAACCAAGCGCGAGGGGCTGGCGTCCCTCCTTCTAAATCAAAAAAGGGGCAGACGCCTGGGGGAGCCCAGTTTGTTGGCTTGGAGTTATATAAACGACTTAAGGAATTTTTGAAGAATTACTTGACAAACCTTCTTAAGGATGGAGAAGATTTGATGGATGAGAGTGTACTGAAGTTCTATACTCAACAGTGGGAAGATTACCGATTTTCAAGCAAAGTGCTGAACGGAATTTGTGCCTACCTCAATAGACACTGGGTTCGCCGTGAATGTGATGAAGGACGGAAAGGAATATATGAAATCTATTCTCTCGCGTTGGTGACTTGGAGAGATTGTCTGTTCAGGCCATTGAATAAACAGGTAACAAATGCTGTTTTAAAACTGATTGAAAAGGAAAGAAATGGTGAAACCATCAATACAAGACTGATTAGTGGAGTCGTACAGTCTTACGTGGAATTGGGGCTAAATGAAGATGATGCGTTTGCAAAGGGCCCTACGTTAACAGTGTATAAAGAATCCTTCGAGTCTCAGTTTCTGGCTGACACAGAGAGATTTTATACCAGAGAGAGCACCGAATTCTTGCAGCAGAACCCGGTTACTGAATATATGAAAAAGGCAGAGGCCCGTCTGCTCGAGGAGCAGCGGAGAGTGCAGGTTTACCTTCACGAGAGCACCCAGGACGAGCTCGCACGGAAGTGTGAGCAAGTGCTCATTGAGAAGCACCTGGAAATTTTCCACACAGAGTTTCAGAACCTGTTGGATGCTGACAAAAATGAAGATCTGGGTCGCATGTATAATCTTGTGTCTAGAATCCAGGATGGCCTAGGAGAATTGAAGAAACTTTTGGAGACGCACATTCATAATCAGGGTCTTGCAGCAATTGAAAAGTGTGGAGAAGCTGCTTTAAATGACCCCAAAATGTATGTACAGACAGTGTTGGACGTTCATAAAAAGTACAACGCCCTGGTCATGTCCGCGTTCAACAACGATGCGGGCTTTGTGGCCGCACTGGACAAGGCTTGCGGTCGCTTCATAAACAACAACGCAGTTACCAAAATGGCACAGTCGTCCAGTAAATCCCCTGAGCTGCTGGCCCGATACTGCGACTCCTTGTTGAAGAAGAGCTCCAAGAACCCAGAAGAAGCAGAACTAGAAGATACGCTCAATCAAGTGATGGTTGTCTTCAAGTACATAGAGGATAAAGACGTGTTTCAGAAGTTCTACGCAAAAATGCTGGCCAAAAGACTGGTGCATCAGAACAGTGCAAGTGATGATGCCGAAGCAAGCATGATCTCTAAACTAAAGCAAGCCTGTGGCTTCGAGTACACCTCTAAGCTGCAGCGGATGTTCCAGGACATCGGCGTGAGCAAAGACCTGAACGAGCAGTTCAAAAAGCACCTGACGAATTCAGAGCCGCTAGACTTGGATTTCAGTATTCAGGTTCTGAGTTCCGGATCGTGGCCCTTTCAGCAATCCTGTACATTTGCCCTGCCGTCGGAGCTGGAACGTAGTTATCAGCGCTTCACAGCTTTTTATGCTAGCCGTCACAGTGGCCGAAAGTTGACATGGTTATATCAGCTGTCTAAAGGAGAATTGGTAACAAACTGCTTCAAAAACAGATACACTTTGCAGGCATCCACGTTCCAGATGGCGATCCTGCTGCAGTACAACACAGAAGACGCGTACGCCGTGCAGCAGTTGGCGGACAGCACTCAGATCAAAATGGACATTTTGGCACAAGTCCTACAGATTTTATTGAAGTCGAAGTTATTGGTCTTGGAAGATGAAAATGCAAACGTCGATGAGGTGGAACTGAAGCCAGACACCTTGATAAAATTGTATCTTGGTTATAAAAATAAGAAATTAAGGGTTAACATCAATGTGCCAATGAAAACTGAACAGAAGCAGGAACAAGAAACCACACATAAAAATATTGAGGAAGATCGCAAACTCCTGATTCAGGCAGCTATTGTGAGAATTATGAAAATGAGGAAAGTTCTGAAACACCAGCAGTTACTTGGAGAAGTGCTCACGCAGCTGTCCTCGCGGTTCAAGCCTCGGGTCCCAGTAATTAAGAAATGCATTGACATTCTGATCGAGAAAGAATATTTGGAGCGAGTGGATGGTGAAAAGGACACCTACAGTTACTTGGCTTAACCCTTCCAGAAGTGTCTGACTGTGCGACCCTCCACACATAGTTCCCGGTGGAAAGGATGAAAACTCGAGCTCATAGCAGCCAGTCTGCCGCCATTTGAACCTCCCTTTTTAAAACTGAGACCAAGACTCCCATCAGCCAGTCTCAGATGTACATCAGAACTGCTCAGGATTGATACATTTCAAGTCTGTAAATATAGACACCGACGCCATTTAACCTAATTTAAGAACAGAGGGGAACCGAACCCTCCACGCCGAGGGCTGCATGCTACTGCATTCAAATCGATACGCTGGCTCCGGGGCTCACAGCTGCCGCCTGAGGCAGCACTTACAGTGTTGGCAGCACTTTGAAAGCGAGTCTGAATGGACCCACGTGTAATCTGCTATGAAAACCCATTTGTATAGTGTGTTTCATTTTTTAATGTGTGAAAATAAAGAAAATTAAAGGATTTCTGTACAAGTTG