Transcript asmbl_56916

Sequence
Transcript Sequence for observation asmbl_56916 of TGE0006435:
AGTTTTGTAGGTTTCGCAACGGTGGTTTCACTTTTGTTAAAACGTTAAGCGGGGTGGAGTAGACTCTCTGGAATACACGATGGCGCAAAAGAAATATCTCCAAGCAAAATTGACCCAGTTTTTAAGGGAAGACAGAATTCAACTTTGGAAACCTCCATATACAGATGAAAATAAAGAAGTTAATTTGGCATTGAAGGACCTCGCTAAGAAGTACTCCGACAAGCTAGAATGTTGCGAAAATGAAGTAGAAAAAGTCATAGAAGAGATTCGTCGCAAAGCAATCGAGCGGGGCACAGGAAATGAAAATTACAAGACGACAGGGATCGCTACAATTGAGGTATTTTTACCTCCACGACTAAGGAAAGATAGGAAAACCCTGTTGGAGACCCGACTGCACATCACTGGCAAAGAACTGAGGTCTAAAATAGCTGAAACCTTTGGATTTCAAGAAAATTATATCAAAATTGTCATAAATAAGAAACAACTTCAACTAGGCAAATCGCTCGAGGAGCAGGGAGTGAAGCACAATGTGAAGGCCATGGTGCTGGAGCTGAAACAGTCCGAGGAGGACGCAAGGAAGAACTTCCAGGACGAAGAAGAAGAGCAGAATGAAGCCAAGCAGAAGGAGAAGCGAATTCAGAGGACCAAGAGAGGGCTGGAGATACTGGCGGAGAGAGCTGAGATGGTGGTGGATCCGGAAACTACACCGTACCTGGATATCGCCAACCAGACGGGCAGATCCATCGAGATCCCGTCGTCGGAAAGAAAAGCCCTTATGTTAGCGATGGGTTATCACGAGAAGGGCAGAGCGTTCCTGAAGAGGAAAGAATATGGAATAGCCTTGCCGTGTCTGCTGGACGCTGACAGATATTTCTGCGAGTGTTGCACAGAACTTCTGGATACAGTGGATAACTACGCGGTCCTCCAGCTGGATATAGTGTGGTGCTACTTCCGCTTGGAACAACTGGAATGCCTTGACGACGCAGAAAAAAAATTAAACTTGGCCCAGAAATGCTTTAAGAATTGTTATGGAGAAAATCATCAGAGACTGGTCAACATTAAAGGAAATTGTGGGAAAGAGAAGGTATTGTTTTTAAGACTTTACCTGCTTCAAGGTATCCGAAATTTTCACAGTGGGAATGGTGAAGAGGCTTCTGAGTATCTCAACAAGGCACGTCAGCTCTTTAAAGAGCTATACATCGATCCATCGAAAGTTCACAGTTTGTTGCAGTTGGGGTTTACCGCCCAGGAAGCCCGGCTTGGCCTCAGGGCCTGTGACGGGAACGTGGACCACGCAGCCACCCACATCACCAGCCGCAGAGAGGAATTGGCCCAAATAAGGAAGGAGGAAAAAGAGAAGAAGAGACTCTGCCTGGAGAACGTAAATGCCCTGAAGGGCATGGGCTACTCCACGCACGCGGCCAGGCAGGCCCTGCAGCAGGCCCGCGGGAACCTGGACGAGGCCCTGCGGATTCTTCTCAGCACCCCTCGGATGTGGTTCAGTGATTCCGACTCGGAAACCAGCAACCATCAAGAAAGTCCTTCCCAGGAAAATATCGACCAACTGGTGTACATGGGCTTCGACACGGCGGCCGCCAGGGCCGCCCTGCGGGTGTTCCGGGGGAACGTGCAGCTGGCCGCGCAGACCCTCGCGCACAACGGGGGAAGTCTCCCGCCCGGCCTGCAGCTCGCGGTGGAGGAGCCTCCGTCGACGCCCTCCACGTCCCCTTCCGACTCTGCAGGTACCTCTAGTGCCTCAACAGATGAAGATATGGAGACAGAGGCCGTCAATGAAATACTGGAAGATATTCCAGAGCACGAAGAAGATTATCTCGACTCGACTCTGGAAGACGAAGAAATTATTATTGCAGAGTACTTATCCTACGTAGAAAATATAAAGTCAGCATCAAAGAAAAACTAAATAATGAACAGAAATAAGTACTAAGTTTCTGCTTATAAATTCTATCGTTATGAAAAGTGTAATGCAGGTCTTCCTTTTTTTTCTTCTTTTCATCTGATTTTGCTCTGGAGTGCTTTCACCTTGGGTGTAGGAGGAGGGTGGGCAGGGGACAGGGACCTGGACGGTGAGAGGAGGAGACTGGGGGCGGGGGCGTGGGTGCTGGTCCTGACAGGTGATCTGAGGACGGAGCCGCCTGCGGCCTGCTCTGCCATCCCCGGCCGCCAGCCGGGTCTGCAGTGTGACGCCGCGCCCACTGGGTCCTTTCCCCGCAGAGTGAAAGGGACTGGGGAATAGGGTGGCCCTGCGGAAGGGCTTGGGGTGGCGAGTTAACGGGGAGAGCGAGCTCCCATCGGTCTCTCTTCTGCCCTCCTGGGCCCCCTGACGGGTGGGGGTGCCACTTCACTGCTGATCTTTTCCTTCTTCCCATGATGCAGCTCTGCCTTCCTGCTTCCTCCTCGCTGTCCCGCCCCGATTGTCCTTCAAATCTTCAGTCATTCCAGGTGCTTTGGGGGCATAAAGGTGAGGCGGCGGCTCCAGTGGCCATACCAAATCGTGCCCGGACACTTTCAGCCCGAAACCAGTGTTTCAAGCTCTTAGTGTAGTTAAATATGCACTTGAAATTCAGAATTTATATGTATTGAGAATTCTTCACAAAAGTAAAATCTTTTATTAAATCAGAAAGTTTTAAATGCTAACAGAAGCAACTTATTTTTAATTAGCATTTTCAGACTCTGCTATCATGTTAAACTCAACGCTGGCTAAGATACCTACCAGAGATCAAGGCATATTTTCTCCAGGTTTTGTGGGGTTTTTTTGGTACATCTATATTACAGAAGACTATTTCTAAAGATACGTGTTTGGCCTCTTAATTGGCCCGACTAACCATTCTCGTCGCGCCGTGAATGCCTCTGTAGTTGTCTATTAATCGAGAACTCATCCCAGCACCAAGACACAGCTGGTGGCGTCGGGGACAGACTGACTCAAGTACCGGATGTGTTCCCAGGACTCTTCCTGCCGTCCCGGAAGTCGCTGGACATTCCTATGACAGGGCAGATGGCTCACTGCCGTGTCCCGTCGGGGCTGGCTGAAATGCTTTGACTTTTTCACTTACTGTTTTCATGACGCTTGGACAGCAGTCCAATTGGAATGGGTGGAAATGTGATTCTTTTAAAATGGATGATTCAGAAAGAAATAAAAGGTAGAAAATATATTCAAAAATTG